File size: 11,777 Bytes
faebe15 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 |
---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/rnacentral
library_name: multimolecule
pipeline_tag: fill-mask
mask_token: "<mask>"
widget:
- example_title: "microRNA-21"
text: "UAGC<mask>UAUCAGACUGAUGUUGA"
output:
- label: "U"
score: 0.22777850925922394
- label: "A"
score: 0.21105751395225525
- label: "C"
score: 0.18962091207504272
- label: "G"
score: 0.11191495507955551
- label: "."
score: 0.09583593904972076
---
# ERNIE-RNA
Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.
## Disclaimer
This is an UNOFFICIAL implementation of the [ERNIE-RNA: An RNA Language Model with Structure-enhanced Representations](https://doi.org/10.1101/2024.03.17.585376) by Weijie Yin, Zhaoyu Zhang, Liang He, et al.
The OFFICIAL repository of ERNIE-RNA is at [Bruce-ywj/ERNIE-RNA](https://github.com/Bruce-ywj/ERNIE-RNA).
> [!TIP]
> The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing ERNIE-RNA did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
ERNIE-RNA is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Variations
- **[`multimolecule/ernierna`](https://huggingface.co/multimolecule/ernierna)**: The ERNIE-RNA model pre-trained on non-coding RNA sequences.
- **[`multimolecule/ernierna.ss`](https://huggingface.co/multimolecule/ernierna.ss)**: The ERNIE-RNA model fine-tuned on RNA secondary structure prediction.
### Model Specification
| Num Layers | Hidden Size | Num Heads | Intermediate Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
| ---------- | ----------- | --------- | ----------------- | ------------------ | --------- | -------- | -------------- |
| 12 | 768 | 12 | 3072 | 85.67 | 22.36 | 11.17 | 1024 |
### Links
- **Code**: [multimolecule.ernierna](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/ernierna)
- **Data**: [RNAcentral](https://rnacentral.org)
- **Paper**: [ERNIE-RNA: An RNA Language Model with Structure-enhanced Representations](https://doi.org/10.1101/2024.03.17.585376)
- **Developed by**: Weijie Yin, Zhaoyu Zhang, Liang He, Rui Jiang, Shuo Zhang, Gan Liu, Xuegong Zhang, Tao Qin, Zhen Xie
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [ERNIE](https://huggingface.co/nghuyong/ernie-3.0-base-zh)
- **Original Repository**: [https://github.com/Bruce-ywj/ERNIE-RNA](https://github.com/Bruce-ywj/ERNIE-RNA)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for masked language modeling:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/ernierna')
>>> unmasker("uagc<mask>uaucagacugauguuga")
[{'score': 0.22777850925922394,
'token': 9,
'token_str': 'U',
'sequence': 'U A G C U U A U C A G A C U G A U G U U G A'},
{'score': 0.21105751395225525,
'token': 6,
'token_str': 'A',
'sequence': 'U A G C A U A U C A G A C U G A U G U U G A'},
{'score': 0.18962091207504272,
'token': 7,
'token_str': 'C',
'sequence': 'U A G C C U A U C A G A C U G A U G U U G A'},
{'score': 0.11191495507955551,
'token': 8,
'token_str': 'G',
'sequence': 'U A G C G U A U C A G A C U G A U G U U G A'},
{'score': 0.09583593904972076,
'token': 21,
'token_str': '.',
'sequence': 'U A G C. U A U C A G A C U G A U G U U G A'}]
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, ErnieRnaModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/ernierna')
model = ErnieRnaModel.from_pretrained('multimolecule/ernierna')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
output = model(**input)
```
#### Sequence Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, ErnieRnaForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/ernierna')
model = ErnieRnaForSequencePrediction.from_pretrained('multimolecule/ernierna')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Nucleotide Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, ErnieRnaForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/ernierna')
model = ErnieRnaForNucleotidePrediction.from_pretrained('multimolecule/ernierna')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
**Note**: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, ErnieRnaForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/ernierna')
model = ErnieRnaForContactPrediction.from_pretrained('multimolecule/ernierna')
text = "UAGCUUAUCAGACUGAUGUUGA"
input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
ERNIE-RNA used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The ERNIE-RNA model was pre-trained on [RNAcentral](https://multimolecule.danling.org/datasets/rnacentral/).
RNAcentral is a free, public resource that offers integrated access to a comprehensive and up-to-date set of non-coding RNA sequences provided by a collaborating group of [Expert Databases](https://rnacentral.org/expert-databases) representing a broad range of organisms and RNA types.
ERNIE-RNA applied [CD-HIT (CD-HIT-EST)](https://sites.google.com/view/cd-hit) with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral, resulting 25 million unique sequences. Sequences longer than 1024 nucleotides were subsequently excluded. The final dataset contains 20.4 million non-redundant RNA sequences.
ERNIE-RNA preprocessed all tokens by replacing "T"s with "S"s.
Note that [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`.
### Training Procedure
#### Preprocessing
ERNIE-RNA used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### PreTraining
The model was trained on 24 NVIDIA V100 GPUs with 32GiB memories.
- Learning rate: 1e-4
- Weight decay: 0.01
- Learning rate warm-up: 20,000 steps
## Citation
**BibTeX**:
```bibtex
@article {Yin2024.03.17.585376,
author = {Yin, Weijie and Zhang, Zhaoyu and He, Liang and Jiang, Rui and Zhang, Shuo and Liu, Gan and Zhang, Xuegong and Qin, Tao and Xie, Zhen},
title = {ERNIE-RNA: An RNA Language Model with Structure-enhanced Representations},
elocation-id = {2024.03.17.585376},
year = {2024},
doi = {10.1101/2024.03.17.585376},
publisher = {Cold Spring Harbor Laboratory},
abstract = {With large amounts of unlabeled RNA sequences data produced by high-throughput sequencing technologies, pre-trained RNA language models have been developed to estimate semantic space of RNA molecules, which facilities the understanding of grammar of RNA language. However, existing RNA language models overlook the impact of structure when modeling the RNA semantic space, resulting in incomplete feature extraction and suboptimal performance across various downstream tasks. In this study, we developed a RNA pre-trained language model named ERNIE-RNA (Enhanced Representations with base-pairing restriction for RNA modeling) based on a modified BERT (Bidirectional Encoder Representations from Transformers) by incorporating base-pairing restriction with no MSA (Multiple Sequence Alignment) information. We found that the attention maps from ERNIE-RNA with no fine-tuning are able to capture RNA structure in the zero-shot experiment more precisely than conventional methods such as fine-tuned RNAfold and RNAstructure, suggesting that the ERNIE-RNA can provide comprehensive RNA structural representations. Furthermore, ERNIE-RNA achieved SOTA (state-of-the-art) performance after fine-tuning for various downstream tasks, including RNA structural and functional predictions. In summary, our ERNIE-RNA model provides general features which can be widely and effectively applied in various subsequent research tasks. Our results indicate that introducing key knowledge-based prior information in the BERT framework may be a useful strategy to enhance the performance of other language models.Competing Interest StatementOne patent based on the study was submitted by Z.X. and W.Y., which is entitled as "A Pre-training Approach for RNA Sequences and Its Applications"(application number, no 202410262527.5). The remaining authors declare no competing interests.},
URL = {https://www.biorxiv.org/content/early/2024/03/17/2024.03.17.585376},
eprint = {https://www.biorxiv.org/content/early/2024/03/17/2024.03.17.585376.full.pdf},
journal = {bioRxiv}
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [ERNIE-RNA paper](https://doi.org/10.1101/2024.03.17.585376) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|