Datasets:

heegyu

/

elsevier-oa-cc-by

like 0

[ "ENGI", "MATE", "PHYS" ]

[ "CAN", "Kissing bond", "NDE", "NDT", "Non-collinear", "Nonlinear", "Ultrasonic" ]

[ "2210", "2500", "3104" ]

[ "Kissing bonds, two surfaces in intimate contact but not bonded together, can be difficult to detect with the non-destructive testing (NDT) techniques that are standard in industry today [1,2].", "For this reason, some structures are over-engineered to allow for the safe failure of an adhesive joint; ‘chicken rivets’ in aeronautical structures are an example of this.", "Kissing bonds are hard to detect with conventional ultrasound techniques because the kissing interface has a transmission coefficient very similar to the properly bonded case.", "This is particularly true when the interface is under compressive load.", "If enough acoustic stress can be applied to the interface the kissing bond will open during the tensile part of the wave.", "This opening and closing of the interface causes contact acoustic nonlinearity (CAN), clipping parts of the waveforms and transferring energy into other harmonics [3,4].", "The research presented here aims to investigate this CAN behaviour in order to create a method for reliable, spatially sensitive, detection of kissing bonds.", "There are many possible ways to detect the acoustic nonlinearity of a kissing bond.", "Measuring the change in transmission/reflection of the fundamental frequency is the simplest but it is insensitive due to the small changes involved [4,5].", "Detecting the harmonics produced is more sensitive [1] but the harmonics often have other potential sources such as the amplifiers, transducers, couplant or the bulk materials themselves [6,7].", "To overcome these problems a more advanced technique is required such as non-collinear mixing, pioneered by Jones and Kobett, and Rollins [8–10] in the 1960s.", "In non-collinear mixing two beams follow different paths that overlap in an area of interest.", "In this overlap region nonlinearities can cause the two waves to interact with each other producing a new one.", "The scattered beam travels in a different direction from the input beams separating its signal from the system harmonics present in the input beams that might otherwise obscure it.", "This creates a method which is spatially selective and when combined with filtration techniques makes it highly sensitive.", "One of the conditions that must be met for bulk nonlinear mixing to occur is that the geometry of the input beams' interference pattern is such that the spacing of the antinodes is the same as the wavelength corresponding to the sum or difference of the input frequencies.", "The two key parameters that control the geometry of the interference pattern are the angle at which the two beams overlap (referred to as interaction angle) and the ratio of their frequencies.", "The optimal conditions were defined as ‘resonant conditions’ in Ref. [8].", "Within the volume of interaction there are two main sources of nonlinearity; the classical nonlinearity of the solids [11], corresponding to the intrinsic bulk nonlinearity, which allows for the mixing of the two input beams as described by Refs. [8,9], and the CAN.", "CAN generates a signal from the kissing bond in the non-collinear case by the combined acoustic forces of the two input waves opening, closing, or unloading the interface enough to allow them to slip when it would be in a different state if only a single wave were applied.", "This modulation generates harmonics in a similar way to the single beam case.", "These perturbations effectively create an array of acoustic sources on the interface which together produce plane waves.", "Another difference between bulk and CAN mixing is that the latter produces scattered beams in both directions from the interface [12,13].", "This can be thought of as being caused by the reflection from the interface when the two overlapping waves open it when it would be closed in the single beam case.", "This effect was not exploited in the following research due to difficulties in positioning an array between the input transducers but the results from transmission testing should be informative of likely reflective behaviour which would be useful for developing a one-sided NDT inspection tool.", "Non-collinear mixing has been used to investigate the state of many different materials including; physical ageing of thermoplastics [14], epoxy curing [14], fatigue in aluminium [15], and oxidative aging of asphalt [16].", "Research into the behaviour of kissing bonds with non-collinear ultrasonic mixing is limited.", "Demčenko et al. conducted testing on PVC plates [17], and there has been modelling conducted by Blanloeuil et al. [13], and Zhang et al. [18].", "The modelling by Zhang et al. focuses on an infinite interface with nonlinear stiffness terms in one case, and a thin region of hyperelastic solid in another case.", "These differ from the work presented here as their interfaces never open but the results are similar in many ways.", "In Demčenko's work the interaction between shear and longitudinal beams overlapping at a kissing bond at fixed angles is investigated.", "If the interface is defined as the x-z plane then the input beams were tested with interaction planes of x-z and y-z.", "When operating in the y-z plane the beams approached the interface from opposite sides.", "The study showed that the interface led to a reduction in nonlinear wave signal in both interaction planes.", "In the work presented here the input beams are in the y-z plane but both approach the interface from the same side.", "Current methods consider the response for single values of interaction angle, ϕ, and frequency ratio, a, usually selected to satisfy the resonance criteria.", "The scattered wave amplitude however may be evaluated for a range of these parameter values, producing a surface within the a-ϕ parameter space.", "There is more information about the material contained within the full parameter space than can be recovered from a single experimental operating point.", "For classical nonlinearity, this parameter space has a characteristic shape, governed by the resonant phasing-matching condition.", "It has previously been observed by Blanloeuil et al. [13] in a numerical study that production of a sum-frequency wave from shear-shear mixing is also predicted by a contact-acoustic nonlinearity.", "The hypothesis examined in this work is that CAN will produce a response within the wave mixing parameter space that is characteristically different from that produced by classical nonlinear terms and that, consequently, analysis of the full parameter space allows the underlying nonlinear mechanics to be identified in addition to the magnitude of nonlinearity.", "Further, by evaluating elastic nonlinearity using the shape of this surface, the measurements become much less sensitive to incident wave amplitude.", "This offers the potential for more experimentally robust nonlinear measurements.", "Herein the shape of the parameter-space response shall be referred to as the ‘fingerprint’ of the nonlinear interaction.", "This study first identifies, through numerical modelling, the expected fingerprints for the shear-shear to longitudinal interaction for the cases of classical and contact-acoustic nonlinearity.", "An experimental program is then undertaken to acquire fingerprints for wave interactions within both bulk material and at an interface.", "Good agreement is found between theoretical and experimental fingerprints.", "The fingerprints of the classical and contact-acoustic interactions are found to be characteristically different in shape, supporting the hypothesis that the fingerprint is a useful tool for the detection of kissing bonds and, more generally, the characterisation of nonlinearity.", "To investigate the parameter space efficiently a computer-controlled, motorised rig was developed.", "The angle of each transducer is independently set, their lateral separation can also be controlled, allowing a constant interaction depth to be maintained with varying interaction angle.", "This is shown schematically in Fig. 1 (a).", "The sample was mounted below the transducers, with an ultrasonic phased array below it in contact with its bottom surface.", "An array was used because as the frequency ratio is changed so is the scattering angle of the produced beam.", "The scattering angle for bulk mixing can be predicted by using the relevant equation from Table 1 of [8].", "The 40 mm length of the array was enough to capture the signal of interest in nearly all cases within the desired parameter space.", "The assembly was placed in a water tank, submerging the input transducers, sample, and array to minimise the coupling variation.", "The temperature of the water was controlled with 0.1 °C precision to maintain a constant speed of sound in water, ensuring reliable refraction angles into the sample.", "The input pulses were generated using Agilent 33250A arbitrary waveform generators and amplified with Amplifier Research 75A250A/100A400 amplifiers.", "The input transducers were Olympus V551-SM's which have an active diameter of 10 mm, a peak frequency of 4.7 MHz, and a −6 dB bandwidth of 3.4 MHz.", "In the testing one transducer was always used at 5 MHz, and the other was varied between 3 MHz and 7.5 MHz.", "This results in the frequency ratio being coupled with the average input frequency which could have an additional impact on the measured fingerprints.", "In future work it might be better to avoid this coupling by changing both the input frequencies in order to keep a constant output.", "To detect the nonlinear signal an Imasonic 10 MHz linear array with a −6 dB bandwidth of 9 MHz was used.", "This array had 128 elements at a pitch of 0.3 mm, and was used in conjunction with a MicroPulseFMC array controller.", "These wide bandwidth transducers allowed frequency ratios between 0.6 and 1.5 to be tested with enough sensitivity to detect scattering even at the extremes.", "The samples discussed in this report were both 2024 T351 aluminium blocks with outer dimensions of 120 × 80 × 60 mm.", "A solid block was used as a reference and another block cut into two halves and compressively loaded together with bolts to simulate a kissing bond.", "The reference block allows measurements of just the bulk nonlinear behaviour.", "The interface testing was conducted with the contacting surfaces finely ground using P1000 grit wet and dry paper (18 μm average particle size).", "Different results would be expected with different surface finishes due to changes in the fraction of the surfaces in contact and the range of angles at which they meet, although this is not tested in this work.", "The torque on the bolts of the two-part block was varied, using a torque wrench, altering the loading on the interface, see Fig. 1 (b).", "The use of bolts along the sides allows unobstructed ultrasonic access to a large section of the block, this gives greater flexibility in the measurements that can be made when compared to the conventional universal testing machine method of loading.", "The main negative of the technique was the random error in loading magnitude due to the unreliable frictional behaviour of the nuts/bolts and the systematic error due to the difficulty in directly measuring the applied load.", "Another limitation was the loading range due to the 5 to 50 Nm torque range.", "Lower torques than this were very inaccurate due to frictional effects, and larger torques would be hard to apply manually.", "The interface sample was sealed with silicone to prevent water ingress when immersed.", "FE modelling, in Abaqus, was conducted to verify that the dimensions of the blocks and bolts should give an even interface loading along the centre.", "This modelling predicted that a torque of 5 Nm should produce a compressive load of 2 MPa in the region of inspection, however due to the experimental samples not being perfectly flat there is likely to be some error in this.", "It should be noted that the approximation of a kissing bond by the compressive loading of the two plates is not intended to produce an interface that is undetectable to conventional linear methods.", "The focus here is on measuring the CAN mixing behaviour in a simplified scenario so that the knowledge can then be applied to the detection of more realistic invisible kissing bonds in later research.", "There are many modes of non-collinear mixing possible [8], investigated in this work is the interaction of two shear waves producing a longitudinal wave at the sum of the two incident frequencies.", "This mode was used mainly due to the simplicity of producing exclusively shear waves over a wide range of angles, and because it allows for the generation of mixing from both the bulk nonlinearities and CAN which enables the bulk signal to be used as a reference for the CAN signal amplitude.", "If the aim of the experiment were to avoid the production of bulk scattering and only produce CAN scattering a different interaction mode, such as the mixing of two longitudinal waves, would be preferred.", "20-cycle Hann-windowed pulses were used for both input transducers.", "These long pulses create a narrow frequency bandwidth which makes the experiment more sensitive to frequency ratio and improves the filtering of the output signal because the energy is within a smaller frequency window.", "The Hann window is used to reduce frequency sidebands.", "For each combination of interaction angle and frequency ratio three measurements were taken; signal with both transducers emitting, signal with just the left transducer, and signal with just the right.", "The signals received from the left and right were subtracted from the case where both were emitting simultaneously (Fig. 2 shows examples of the time data at various points of acquisition and processing).", "In plots a, b, and c of Fig. 2 the side lobes of the input pulses dominate but after subtraction, shown in plot d, the scattered pulse becomes visible.", "Note the different colour scales.", "Filtering at the sum frequency, Fig. 2 (e), removes nearly all of the remaining unwanted signal allowing the pulse of interest and its echoes to be clearly seen.", "Pulse inversion is a commonly used technique in nonlinear ultrasonics [19–21] as it can be used to remove either the even or odd harmonics from the signal.", "However, it is less useful in sum-frequency non-collinear mixing since the signal of interest is at a similar frequency to the second harmonic of the input beams when the frequency ratio is close to one.", "In non-collinear mixing the second harmonic component of the input beams' side lobes is commonly the largest source of unwanted signal that remains after processing in the way detailed in the previous paragraph.", "Conventional pulse inversion is not able to remove these side lobes while enhancing the sum-frequency scattered wave.", "There is a more advanced form of pulse inversion where all combinations of inversions of the input pulse are applied, requiring a total of four firings [22].", "This method was not used in the experimentation presented here but it looks very promising for future work.", "A window of the data in time and space was selected based upon the predicted time of arrival and angle of scattering, as stated in Ref. [8].", "This window removed most of the unwanted signal from the sidelobes of the input beams that normally arrived later than the signal of interest.", "Focusing on reception was then performed to enhance the measurement of the wave scattered by the interface.", "To do so a delay is applied to each element's response, depending on the position of the element within the array and its location with respect to the interaction volume.", "The remaining signal was then summed element-wise to complete the focusing operation.", "Finally, the Hilbert transform was used to acquire the envelope of the signal and the peak value of this was recorded.", "This value is used as the metric of scattering and referred to in later figures as ‘peak scattering amplitude’.", "By recording this scattering value for the range of input parameters a ‘fingerprint’ can be made.", "These steps are shown as a flowchart in Fig. 3.", "A program of numerical modelling was undertaken in order to determine the independent contribution of both the classical and contact acoustic nonlinearity on the wave mixing parameter space.", "The modelling is also useful to inform which areas of the parameter space are likely to be of interest so that the experiment can be designed to include these ranges.", "Knowledge of the experimental geometry, apparatus, and processing techniques is used in the production of models that more accurately relate to the experimental measurements.", "Many factors such as transducer bandwidth, mode conversion at the water-aluminium interface, and interaction volume have significant impacts on the resulting fingerprints so are included in the following results.", "It can be seen in Fig. 4 that the strongest mixing response is predicted at 118° and a frequency ratio of 1.06.", "This is approximately the same angle as the resonance angle given by the equation stated in Ref. [9], 120°.", "There are also two secondary lobes of nonlinear scattering that can be seen at smaller interaction angles, peaking at around 100° and 85°.", "The reduction in amplitude at frequency ratios far from 1 is due mainly to the bandwidth of the transducers, and the cut off at angles smaller than 60° is caused by very little production of shear waves at the water/aluminium interface below the first critical angle.", "These results predict that there are multiple features in the fingerprint within the 60°–140° that might interfere with the CAN signals of interest presented in the following section.", "The nonlinearity of the kissing interface is very different from the classical bulk nonlinearity, as such it is not obvious based upon previously established theory that the interface would cause two incident shear waves to interact to produce a scattered longitudinal wave.", "The modelling conducted in this section shows that a kissing interface can cause non-collinear mixing, as others have done previously, and it explores the parametric sensitivity of the mixing.", "The behaviour of a contacting interface requires a model that can accurately capture how the interface can be in one of three states, strongly closed (transferring transverse and normal stresses), slipping (transferring only normal stress), and open.", "This was achieved using a 2D plane strain FE model.", "The model is similar to the one reported in Ref. [13], with differences in terms of geometry and incident frequencies.", "The main characteristics of the FE model are detailed below for completeness.", "This model does not include the higher order elastic terms so classical bulk mixing should not occur.", "The model consisted of 720000 elements, 723002 nodes (each node has two degrees of freedom) and took about 11 h to solve for each parametric point on an average desktop PC.", "Since 130 different points in the parameter space were investigated over 1000 h of computation time was required to generate the fingerprint.", "The code does not currently make use of parallel or GPU computing so it might be possible to reduce the time requirements by these methods in the future.", "Since the model used for this work is presented in other publications further details will not be shown or discussed here.", "The following is about the resulting fingerprint produced when the time signals from an array of points below the crack are processed in the same way as defined in the experimental methods section.", "The modelling demonstrated the possibility of bulk mixing happening at smaller interaction angles than its resonance condition.", "This could potentially obscure interface mixing measurements so testing of solid material must be done first to understand its influence on later interface fingerprints.", "Fig. 6 shows the nonlinear response of aluminium 2024 T351, with the interaction volume's centre at 18 mm below the surface of the 60 mm thick block.", "In this most simple case the fingerprint has only one peak, at the angle predicted by the classical equations [8,10].", "Fingerprints have been taken at various input power levels and depths (10 mm–30 mm) into the material, despite these changes the fingerprint remains largely unchanged in shape.", "The intensity of the pattern is proportional to the product of the input beams' amplitudes, as expected.", "Fig. 7 shows the fingerprint of the solid aluminium at a depth of 30 mm (the centre of the sample).", "The fingerprint is quite similar to that taken at 18 mm, again showing only one peak in response approximately at the resonant condition.", "There are some slight differences between measurements at 18 mm and 30 mm however.", "The decrease in intensity at angles greater than 125° at 30 mm deep is due to a geometric limitation that reduces the fraction of the beams able to propagate into the sample.", "This is caused by the larger input beam separations required for deeper interactions.", "Another notable difference between the two fingerprints is their overall amplitude; at 18 mm deep the scattering response is nearly twice that at 30 mm.", "This is mainly due to beam divergence as they propagate through the sample, reducing beam amplitude but increasing volume of interaction.", "The scattering amplitude is proportional to the interaction volume and the square of the input amplitude.", "The combination of these two factors results in scattering amplitude being proportional to the inverse of beam radius at the interaction point.", "The classical modelling predicted that there would be a primary mixing peak at 118° ranging from 110° to 130°, this matches the experimental data very well, Fig. 6.", "It also predicted the existence of smaller peaks in mixing at angles of 100° and 85°, Fig. 4, with the 100° peak having a quarter of the magnitude of the main mixing region.", "It does not look like these secondary peaks are present in the experimental fingerprint.", "There is some signal visible between 95° and 106° experimentally but it is much smaller than predicted and is likely due to poor filtration of input beam side lobes at frequency ratios close to 1.", "Otherwise the model and experiments agree well showing a main mixing region between 110° and 130° and similar behaviour in terms of frequency ratio.", "Now that a benchmark for solid aluminium mixing has been obtained the interface sample can be studied for comparison.", "Fig. 8 shows a fingerprint of the compression loaded interface sample, with the volume of interaction centred on the interface.", "The reduction in signal seen at 125° and greater is due to the geometric limitation mentioned previously in Section 4.1.", "A peak in mixing behaviour is observed at around 75° and a frequency ratio of 0.9 in this case.", "There is a much smaller peak at around 100°, and a very slight peak at frequency ratios around 0.85 at 120°.", "Figs. 6–8 were normalised to the maximum scattering amplitude of the three which occurred in the interface case.", "The maximum scattering amplitude from the interface was an order of magnitude larger than that from the solid sample at the same depth.", "The most useful trends in the fingerprints appear to occur in the interaction angle dimension therefore further testing was conducted at a single frequency ratio, 0.9.", "This was selected as it was near the peak response points of both solid and interface samples and far enough away from 1.0 that it had reduced noise from the frequency filtering.", "Values for the peak scattering amplitude are presented in two ways in the following sections.", "In part a of the figures the values have been normalised by the peak value obtained in the kissing interface fingerprint, Fig. 8.", "In part b the data is normalised by the peak scattering of each parametric sweep.", "The former is to allow for absolute amplitude trends to be compared and the latter for comparison of fingerprint shapes.", "Fig. 9 (a) shows the scattering response of the interface region at a frequency ratio of 0.9 with bolts torqued between 10 Nm and 40 Nm.", "This range was used because very little signal was observable with the torque below 10 Nm, and 40 Nm was as much as could be applied to the sample with the torque wrench.", "Since it is very difficult to know accurately the interface pressure with this experimental method bolt torque will be referred to as the controlled variable.", "The two are predicted to be directly proportional, ignoring microscopic contact changes.", "The sample was preloaded to 40 Nm before the two full loading cycles, ‘a’ and ‘b’, were tested.", "For the cycles the bolts were torqued to 10 Nm initially then increased in steps of 10 Nm up to 40 Nm.", "As the loading was increased the amount of mixing increased.", "When 10 Nm was applied the main CAN related peak is seen at around 76°, this shifted approximately 2° towards smaller interaction angles as the load increased.", "This plot also shows that there was an overall trend of increased scattering with each loading cycle.", "This can be explained by the fact that the interface was never fully unloaded during these cycles, each bolt was unloaded from 40 Nm and re-tightened to 10 Nm in turn, keeping the faces in constant contact.", "This method was intended to stop the faces moving relative to each other between each cycle, keeping the same parts of the interface in contact.", "Due to this it is expected that the surface asperities will gradually deform to match each other with each cycle, increasing the contact between the two faces and thus the transmission.", "In the paper by Blanloeuil et al. [13] the FE modelling predicted that the maximal mixing response occurs when the interface load is 0.25 that of the peak combined acoustic loading.", "The experimental acoustic loading was estimated by using a laser vibrometer.", "A measurement was taken with one of the input beams at normal incidence on a 30 mm thick aluminium sample.", "The surface deflection due to the longitudinal wave that propagated through the sample was converted into an acoustic stress.", "Using mode conversion calculations an estimate was made of the combined acoustic stress of two shear waves in the aluminium that would be created when an interaction angle of about 80° is used.", "The resulting value was 0.1 MPa, but due to the many approximations involved this is probably only accurate to an order of magnitude.", "Using this value of acoustic stress gives an expected peak response at 0.025 MPa interface loading which corresponds to bolts torqued to 0.05 Nm.", "This is much smaller than the experimentally tested range of 10–40 Nm in which the mixing was observed increasing with load.", "The laser vibrometer measurement and torque to interface pressure estimations were quite rough but a disagreement of at least three orders of magnitude suggest that there is likely another source of difference between the model and experimental measurements.", "One possible difference is the smoothness of the interface with the modelling being perfectly flat and having completely evenly distributed loading.", "To demonstrate the repeatability of the method a plot of measurements taken at 40 Nm torque is shown in Fig. 10.", "It contains a parametric sweep taken after the plates were first loaded to 40 Nm (the pretest measurement), another taken after the load was released and then reapplied on each bolt in turn (a), and two after a second load cycle (b).", "The sample was removed from the immersion tank and replaced between the two ‘b’ tests.", "It can be seen in Fig. 10 (a) that the pretest measurement had amplitudes 25% smaller than the cycles that followed, and that there was about a 10% variation in amplitudes of cycles a and b.", "The variation in amplitude with cycle number is expected as surface asperities are altered by each successive cycle, although most of the deformation occurs during the first [4].", "Initially the surfaces only contact where they are locally raised.", "Due to the small area in contact this area is under high load and unable to be overcome by the acoustic stress.", "The remaining troughs are not in contact so transmit no signal.", "The combination of these factors leads to small CAN signals when the plates are first brought together but cause the signal to increase as the surfaces conform to each other.", "This process is expected to be more dominant in a roughly ground interface case than for a polished interface because the asperities of the polished interface should be much smaller and form a better match initially.", "The normalised data in Fig. 10 (b) displays very good agreement between the measurements, only the pretest response significantly differed from the others, having a smaller 120° to main peak ratio.", "Some difference would be expected due to the changing interface condition discussed above.", "This data gives an indication of the repeatability of the measurement, showing that peak normalisation results in consistent parametric trends when the sample is unaltered.", "Measurements taken consecutively without the removal of the sample were conducted, these showed even smaller variation than seen above, leading to the conclusion that positioning of the sample is the primary cause of the slight variation observed in ‘40Nm b’ trends in Fig. 10 (b).", "The impact of positioning is explored in the following section.", "There is almost certainly some variation in the average surface height of the blocks between points a few millimeters apart due to the limitations of the production method used, therefore it is expected that some macroscopic regions of the interface will be under greater average load than others despite efforts to design a geometry that minimises loading variability.", "Due to this it might be expected that testing a different region of the interface could yield a fingerprint that resembles another taken at a different torque setting.", "To investigate this the interface sample had scattering measurements taken at various points along the central axis of the sample, specifically at 0, 2, 4, and 5 mm from the centre.", "In Fig. 11 (a) the unadjusted arbitrary amplitudes can be seen.", "The bolt torque was 40 Nm for this testing.", "The reduction in signal observed at above 120° for increasing displacements is related to the input beam clipping issue mentioned previously.", "The largest difference between measurement points in Fig. 11 (a) was the drop in amplitude when displacing from the central position.", "Moving only 2 mm caused a 25% drop in signal.", "The diameter of the interaction area on the interface at the -3 dB limits is estimated to be 21 mm by beam divergence calculations (-3 dB was selected rather than -6 dB due to the scattering being a product of the square of the input amplitude).", "In the 2 mm translation roughly 12% of the initial surface area moved outside of the new overlap area.", "It is possible that a highly CAN active area of the interface was moved outside the interaction region and that the new area was not very active, but the disproportionately large change of 25% means this is unlikely.", "Another possible explanation is proposed at the end of this section.", "Fig. 11 (b) also contains some interesting trends.", "The width of the main peak is much larger at 4 mm displacement and it has a rounded peak.", "The peak response interaction angle varies by about 4° between the tests and the smaller peak at 100° does not exist other than at 0 mm.", "Some of these trends are similar to those observed as load was varied in Fig. 9, such as peak shifting, but others are quite different, e.g. the large peak width changes.", "This implies that the shape of the response must be related to more than just average interface loading within the interaction area, indicating that there are other factor(s) causing the variation despite the surfaces being uniformly rough.", "The combination of the rapidly changing amplitudes and shapes of the parametric trend therefore probably have a more complex cause than has been discussed above.", "One explanation is that the overlapping input shear waves constructively produce lines of positive and negative tensile stress on the interface with regions of destructive interference in between.", "It is these lines where the waves cancel each other that create transmission at the interface when otherwise it might be open due to the tensile forces of the individual beams, thus these lines are the sources of the non-collinearly mixed signal.", "The lines have a spacing of approximately 1 mm (dependent on interaction angle and frequency ratio) and are at fixed places on the interface when the frequency ratio is one.", "At other ratios these sampling lines sweep across the interface during the pulse, sweeping faster the further ratio is away from one.", "For the case of a 0.9 ratio, as used in this study, the sampling lines will shift back to the starting pattern over the course of 10 cycles of the reference input beam (at 5 MHz in this research).", "Therefore, the experiment's sensitivity is biased towards the lines of the interface that are sampled when the input pulses are near their maxima due to the peak scattering amplitude being used as the measurement metric.", "Movement of the sample or change in the interaction angle causes the position of the sampling lines to be altered resulting in the complex parametric-space response that was observed.", "The non-collinear interaction of two shear waves in a dry, aluminium, compression loaded interface has been studied over a wide range of interaction angles and frequency ratios in the sum-frequency, shear-shear mixing regime at around 5 MHz, forming ‘fingerprints’ of the interface.", "This sample is intended to simulate an acoustically simple case of a kissing bond to allow the fundamentals of a non-collinear approach to detecting more realistic kissing bonds to be developed.", "The kissing interface sample displayed nonlinear scattering fingerprints very different from reference solid sample, producing signal at interaction angles between 60° and 120°.", "At all points in the loading range investigated a characteristic shape was produced, peaking at around 75°.", "This fingerprint was similar to that predicted by Blanloeuil's FE modelling [13] except for the secondary peaks in the 100°–120° region in some cases.", "These peaks were most prominent at higher compressive loads and their cause is unclear.", "Frequency ratio was not studied in detail in this work as the initial fingerprints had few apparent features in this dimension.", "It has been shown that mixing behaviour away from the peak conditions may contain useful information about the interface; e.g. the trends at around the 100° region relating to the interface loading.", "The interaction angle of peak mixing may be another indicator of interface loading.", "In this study the peak amplitude correlated well with the interface loading but this trend is not expected to continue at higher contact pressures/lower acoustic pressures, as the interface becomes too highly loaded to be separated by the acoustic waves.", "There is potential benefit to measuring multiple fingerprint features related to the same interface/material parameter as it would improve the robustness of the method.", "When different regions of the interface were probed the parameter space changed in ways that did not match with the changes observed due to varied loading.", "Therefore, further testing of different samples and parts of their interfaces is required to understand the general parametric behaviour of kissing interfaces.", "It is hypothesised that the position sensitivity is partly due to the non-collinear method only sampling the regions of the interface where the component of stress normal to the interface of the input beams cancel, forming an array of sampling lines.", "Further testing of a smoother interface in terms of position sensitivity would be of interest in relation to this phenomenon as it would be expected to have properties that vary less spatially.", "It would also be of interest to test kissing interfaces at higher mechanical compressive loading to investigate the point at which the loading becomes too great for the acoustic waves to separate the surfaces.", "The secondary peaks in the interface fingerprints were not predicted by the FE modelling or observed in the solid sample.", "The precise nature of their source is not known but could be linked to the sampling lines theory mentioned in the previous paragraph.", "It might be that particular interaction angles sampled the interface at more active regions creating the peaks in response, in a similar way to how the peaks changed when the sample was moved.", "At low loads the interface had a smoother parametric response.", "Combining this fact with the sampling theory suggests that the interface has a more uniform contact profile at low loads.", "Another possible explanation relating to the load based behaviour is that at low loads the interfaces meet more unevenly and the increased deviation in contact angle from the macroscopic surface normal causes a smoothing of the response due to a wider distribution of interaction angles experienced at the microscopic level.", "This concept alone does not explain the existence of secondary peaks at higher loads however so perhaps it is a combination of effects.", "These behaviours indicate that the system is highly complex, probably requiring more advanced models and further experimentation to fully understand the impact of kissing bond parameters on their fingerprints.", "In the future use of focusing on input beams would allow interaction regions with far fewer overlapping wavefronts to be made.", "This would probe the interface in greater detail and might confirm if the position sensitivity trends observed with larger interaction areas were a result of interface properties varying on a wavelength scale.", "If using unfocused beams sweeping the interaction nodes along the interface, perhaps by altering the phase of the beams, and summing the responses together might be a route to measuring a more averaged scattering value for the interaction area.", "Alternatively frequency ratio ratios further from one with longer pulses could achieve a similar level of sampling coverage.", "This could be useful if a faster measurement is required than scanning a focus across the whole area and would also ensure that no parts of the interface are unsampled.", "In this work there was only one interface at a known depth, in this case a non-collinear c-scan could have been conducted by moving the input transducers and array along the sample.", "If the defect is at an unknown depth the technique could be easily extended to 3D by sweeping the depth of the interaction volume.", "The fingerprint at each location might then be analysed to identify the properties of the sample within the interaction volume, allowing 3D positional detection of kissing bonds." ]

[]

[ "AGRI", "EART", "ENVI" ]

[ "Dark incubation", "Esterase substrate", "Flow cytometry", "Inactivation", "Tetraselmis suecica", "Ultraviolet irradiation" ]

[ "1104", "1910", "2310" ]

[ "Ships use water as ballast to ensure stability and trim during the voyage, and ambient water is pumped into ballast tanks in the hull of the ships.", "It is traditionally discharged without any treatment and represents a global vector for aquatic invasion.", "A multitude of organisms like virus, bacteria, algae and zooplankton are carried around the world in ship's ballast tanks (David et al., 2007; Drake et al., 2007; Hallegraeff and Bolch, 1991).", "Some organisms survive in ballast tanks and are released into new environments.", "If nonindigenous species adapt and establish in a new environment, they might have an impact on the native species and cause ecological change in the ocean (Gollasch et al., 2015; Ruiz et al., 1997).", "It is of importance to minimize and prevent dispersal of species by ballast water discharge to hinder potential harm to ecosystems, the economy, or human health (Ruiz et al., 2000).", "In 2004 the International Maritime Organization (IMO) established standards for ballast water treatment through the International Convention for the Control and Management of Ship's Ballast Water and Sediments (International Maritime Organization, 2004).", "Regulation D-2 of the Convention sets the standard regarding category and concentration of organisms at discharge.", "The Convention will enter into force 12 months after being ratified by 30 States representing 35% of the merchant shipping tonnage.", "In August 2015 44 States, representing 32.86% of the world tonnage, have ratified the Convention.", "The upcoming IMO regulations have led to development of various ballast water treatment systems (BWTS) that facilitate disinfection of ballast water (David and Gollasch, 2015; Delacroix et al., 2013; Lloyd's Register Marine's, 2015a, 2015b; Stehouwer et al., 2015; Werschkun et al., 2012, 2014).", "All BWTS have to be approved by national authorities according to IMO regulations and/or the regulations of other national bodies (e.g. U.S. Coast Guard (USCG)).", "When selecting and installing a BWTS, the shipping companies have to consider different technical and operational aspects (Lloyd's Register Marine's, 2015a, 2015b).", "The BWTS use a range of different treatment technologies, from processing the water with solid–liquid separation to chemical- (active substances) and/or physical disinfection (e.g. UV).", "The main operational cost for UV based BWTS is related to power consumption (Werschkun et al., 2014).", "Ship owners can reduce such costs by lowering the UV intensity, providing that the ship's discharged ballast water still complies to Regulation D-2 (International Maritime Organization, 2008a).", "It is therefore of interest to determine the lowest lethal UV dose and to estimate the time required for inactivation when stored in ballast tanks after irradiation.", "UV irradiation is performed either by low pressure (LP) or medium pressure (MP) UV lamps (Oguma et al., 2002; Werschkun et al., 2012; Zimmer and Slawson, 2002).", "LP lamps emit UV-C radiation, primarily at 254 nm, which is most efficiently absorbed by nucleic acids and causes DNA damages (Sinha and Häder, 2002).", "UV induced DNA damages can be reversed by DNA repair mechanisms, referred to as photoreactivation and dark repair (Sancar and Sancar, 1988; Sinha and Häder, 2002).", "MP UV lamps emit radiation spanning the UV-A, -B and -C bands causing additional damage to proteins and enzymes.", "For instance, UV-B radiation can affect key components in photosynthesis (Fiscus and Booker, 1995; Holzinger and Lütz, 2006; Kottuparambil et al., 2012), causing energy deprivation in phytoplankton cells.", "Thus, it has been argued that MP UV lamps can cause a higher degree of inactivation compared to LP UV lamps (Kalisvaart, 2001; Oguma et al., 2002).", "UV irradiation can leave cells in different conditions (live, dead or damaged), whereof the viability of damaged cells at discharge is uncertain (Olsen et al., 2015).", "Damaged cells can be unculturable, though they can be metabolic active and may pose a health risk (Oliver, 2010).", "Further, cellular DNA repair mechanisms can restore the genetic information (Sancar and Sancar, 1988; Sinha and Häder, 2002; Zimmer and Slawson, 2002) causing the cell to grow and replicate after discharge (Liebich et al., 2012; Martínez et al., 2012, 2013).", "Additionally, the terminology describing the organisms at discharge can be confusing or unclear.", "The IMO Convention refers to “viable” organisms (International Maritime Organization, 2004), and the Guidelines for approval of ballast water management systems (G8) define “viable organisms” as “organisms and any life stages thereof that are living” (International Maritime Organization, 2008a).", "USCG also uses the term “living” (United States Coast Guard, 2012).", "Determining the condition of UV irradiated cells is a complex task.", "On the other hand, cheap, fast and reliable methods to analyze ballast water are necessary for approval of BWTS technologies and for compliance testing of ballast water discharge (International Maritime Organization, 2013).", "Testing for compliance can be performed in two steps; an indicative and a detailed analyses.", "An indicative analysis is a relatively simple and quick measurement that gives a rough estimate of the number of viable organisms in the ballast water at discharge.", "Examples of indicative analysis methods are e.g. BallastCAM and various fluorescence or ATP detections (Drake et al., 2014; First and Drake, 2013, 2014; Gollasch and David, 2012, 2015; van Slooten et al., 2015).", "If an indicative analysis shows compliance to Regulation D-2, there is no need for a detailed analysis.", "Should the indicative analyses be non-compliant, however, a detailed analysis must be undertaken to give robust and direct measurements determining the concentration of viable organism in ballast water discharge according to Regulation D-2.", "Quantification of live bacteria traditionally relies on cultivation methods, which is time-consuming and may give false negatives as several species are uncultivable although viable (Roszak and Colwell, 1987; Staley and Konopka, 1985).", "Flow cytometry (FCM) has been suggested as a promising method for detailed analysis (International Maritime Organization, 2013; Peperzak and Gollasch, 2013).", "FCM facilitates rapid detection, enumeration and characterization of organisms in combination with fluorescent dyes, and enables to study populations and communities indirectly (Peperzak and Brussaard, 2011; Shapiro, 2000).", "Previously a FCM protocol was developed to distinguish between live and dead Tetraselmis suecica cells (Olsen et al., 2015).", "For UV irradiated samples the FCM protocol could not distinguish between live and damaged cells, as the latter contain both dying and repairable cells.", "The current study uses the FCM protocol to elaborate on different UV doses and the effect of dark incubation on inactivation of the algae T. suecica, to simulate a ballast water treatment and subsequent transport.", "Our specific objectives were to:", "Determine the minimum UV dose that permanently inactivates the algae.", "Quantify effects of different UV doses on T. suecica.", "Estimate the time of dark incubation required to permanently inactivate the algae treated with UV doses lower than minimum permanently inactivation dose.", "Provide recommendations for ballast water management.", "The phytoplankter specie T. suecica (Strain K-0297, Scandinavian Culture Collection of Alga and Protozoa, University of Copenhagen, Denmark) was selected as a test organism.", "It was cultured in 24 PPT artificial sea water (Marine SeaSalt, Tetra, Melle, Germany) added 0.12% Substral (The Scotts Company (Nordic) A/S, Naverland, Glostrup, Denmark), at 15 °C, 100 rpm, 14:10 light:dark cycle and 90 lx light intensity (Flora-Glo, T8, 20 W).", "The culture was diluted in growth medium to a density of 104 live cells ml− 1 prior to irradiation, monitored by FCM.", "Irradiation was performed using a collimated beam MP UV lamp (800 W) (BestUV, Hazerswoude, The Netherlands) (Olsen et al., 2015).", "For each experiment three samples of 15 ml diluted T. suecica culture were irradiated with the same UV dose in a petri dish (inner diameter 6 cm, culture depth 7 mm) while mixed with a 1 × 0.4 cm magnetic stir bar at 200 rpm in room temperature (RT).", "The intensity (mW/cm2) of the UV lamp was fixed and the exposure times used were 155, 233, 311, 622 and 1244 s for UV doses 100, 150, 200, 400 and 800 mJ/cm2, respectively.", "The irradiated samples were transferred to sterile 50 ml polypropylene tubes (Fisher Scientific), so was the control samples, including 2 × 15 ml non-irradiated cells and 10 ml dead cells.", "The dead cells were killed by fixation with formaldehyde at 5% final concentration (36.5–38% formaldehyde, Sigma-Aldrich).", "All tubes were wrapped in aluminum foil and incubated in the dark with loosened lids at 15 °C.", "First, a pre-study over 5 days was performed to observe the inactivation effect of different UV doses and dark incubation, and to test whether this effect was interpretable with FCM.", "This was followed by two complete experiments, denoted as exp-I and exp-II, and an overview of the set-up for these experiments is given in Fig. 1.", "For FCM analysis, the samples were stained with 5-carboxyfluorescein diacetate acetoxymethyl ester (CFDA-AM) and analyzed with an Attune Acoustic Focusing Cytometer (Olsen et al., 2015).", "The samples in the pre-study were analyzed at days 1, 3 and 5 after treatment.", "In exp-I samples were analyzed at days 1, 3, 6, 9, 13 and 22, and in exp-II samples were analyzed at days 1, 3, 6, 10, 15 and 22 after treatment (Fig. 1).", "The samples in exp-I and -II were analyzed at different intervals due to logistics.", "A previously defined gate (i.e. a collection of single cell FCM-signals) in the FCM dot plots was used for analysis.", "The gate was defined based on plate count results from non-irradiated cells, and regression analysis was used for validation of the gate (Olsen et al., 2015).", "To determine the number of culturable cells, plate count analysis was performed 1 day after UV treatment (Olsen et al., 2015).", "Also at day 1, a most probable number (MPN) analysis was performed.", "The samples were diluted in growth medium (24 PPT artificial sea water added 0.12% Substral) in 10-fold series up to 10− 4 dilution to a total volume of 1 ml pr.", "well in 48 well plates (Greiner Bio-One, Austria) and incubated at 15 °C, 14:10 light:dark cycle and 90 lx light intensity.", "Positive growth was determined by a change in color into green as detected by the eye, and scored against the MPN table for a three-replicate design from FDA's Bacterial Analytical Manual (U. S. Food and Drug Administration (FDA), 2010), which gives rough results in intervals.", "When the numbers of live/damaged cell signals in FCM dot plots were approximately 10% of the total number of cells, a regrowth check was performed for verification.", "For exp-I this procedure was carried out at day 22 for samples treated with 100–200 mJ/cm2 and at day 2 for samples treated with 400 and 800 mJ/cm2, and for exp-II at day 20 for samples treated with 100–200 mJ/cm2 and at day 3 for samples treated with 400 and 800 mJ/cm2.", "1 ml of the sample was added to 9 ml growth medium in 50 ml Erlenmeyer flasks.", "No visible change to green color indicated that there were no reproductive cells in the sample.", "The flasks, trays and plates were incubated at 15 °C in the dark for 3 weeks.", "FCM analysis in the pre-study showed that inactivation increased with higher UV doses and during the dark incubation period (data not shown).", "Based on these results, two complete experiments were carried out (exp-I and -II), and these results are presented below.", "UV irradiation with doses ≥ 400 mJ/cm2 inactivated the algae permanently as demonstrated by all analysis methods.", "FCM analyses (Fig. 2b, d) of samples irradiated with 400 and 800 mJ/cm2 displayed < 4% and ≤ 0.1% live/damaged cell signals after 1 day, respectively.", "The numbers of live and damaged cells remained at this level or were further reduced during the incubation period.", "Plate count and MPN did not show any growth at UV doses ≥ 400 mJ/cm2 and neither did regrowth check performed at days 2 and 3 for exp-I and exp-II, respectively.", "As observed in the pre-study, FCM analysis of UV irradiated samples showed a relationship between inactivation and UV doses.", "This was examined at day 1, when an immediate effect of UV treatment was observed, and again the number of live/damaged cells decreased with higher UV doses.", "Table 1 shows a comparison of the results from FCM, MPN and plate count from exp-I and -II.", "The control samples were all in the same range, but MPN results showed > 11,000 cells ml− 1, indicating that the samples should have been diluted further.", "The results for the UV irradiated samples, varied when using different analysis methods.", "In exp-I there were good agreements between live/damaged cell numbers obtained by FCM and MPN analysis, but the plate count analysis resulted in considerably lower numbers at day 1.", "For exp-II, comparable results were obtained using plate count and MPN analysis whereas the results using FCM gave considerable higher live/damaged cell numbers.", "For samples treated with UV doses 100, 150 and 200 mJ/cm2 inactivation of cells was dependent on time of dark incubation as demonstrated by FCM (Fig. 2a, c).", "Generally, the numbers of live/damaged cells decreased during incubation, and were fewer in UV irradiated samples than in the stained controls.", "In exp-I the percentage of live/damaged cells in the UV irradiated samples (Fig. 2a) decreased throughout the incubation period and amounted to ≤ 3% at day 22.", "The samples treated with 100 mJ/cm2 behaved similar to the stained controls during incubation, but at day 22 the percentage of live/damaged cells was lower than the stained controls also for samples treated with this UV dose.", "In exp-II (Fig. 2c) inactivation increased during incubation, and < 3% live/damaged cells were observed at days 22, 10 and 3 in the samples treated with 100, 150 and 200 mJ/cm2, respectively.", "Regrowth checks performed at days 22 and 20 for exp-I and exp-II, respectively, were negative for all UV irradiated samples and positive for the control samples (data not shown).", "Considerable variations were observed between the results from the two experiments when looking at a detailed level.", "Firstly, the percentage of live/damaged cells in the stained controls varied at day 1 (Fig. 2a, c), being 92% and 54% in exp-I and exp-II, respectively.", "Secondly, for the samples UV irradiated with ≤ 200 mJ/cm2, the inactivation rate varied between the experiments (Fig. 2a, c) and the number of FCM live/damaged cells fluctuated (Table 1).", "Thirdly, some replicates showed large standard deviations; most evident in exp-I (Fig. 2a).", "Fourthly, at the first days after UV irradiation, it was observed more cells in the treated samples than in the controls (Table 1).", "The aim of this study was to evaluate inactivation by different UV doses and dark incubation on the algae T. suecica, to give recommendations for ballast water management regarding treatment and transport.", "UV doses 400 and 800 mJ/cm2 rendered T. suecica cells unculturable and without esterase activity 1 day after irradiation whereas doses ≤ 200 mJ/cm2 did not necessarily inactivate the cells.", "This indicates that the minimum UV dose that permanently inactivates this algal specie is somewhere between 200 and 400 mJ/cm2 which is similar to the dose Ou et al. (2012) found to be lethal after UV-C radiating the cyanobacteria Microcystis aeruginosa (Ou et al., 2012).", "The samples irradiated with UV doses 100, 150 and 200 mJ/cm2 contained culturable and esterase active T. suecica cells 1 day after irradiation, but the inactivation increased with higher UV doses.", "Our results are in line with previous studies of freshwater green algae Chlorella ellipsoidea, Chlorella vulgaris, and Scenedesmus quadricanda, and the cyanobacteria M. aeruginosa which showed limited sensitivity to UV-C irradiation with doses ≤ 200 mJ/cm2 (Ou et al., 2012; Tao et al., 2010).", "Comparing the different analysis methods at day 1 for the samples UV irradiated with doses ≤ 200 mJ/cm2 revealed that the numbers of FCM gated cells were higher than the numbers of cfu detected by plate count.", "Such discrepancy between plate count and FCM results has also been observed in other studies of UV irradiated bacteria and alga (Kramer and Muranyi, 2014; Olsen et al., 2015; Schenk et al., 2011).", "UV induced DNA damage can block transcription and replication, inhibiting growth and reproduction (Oguma et al., 2002; Sinha and Häder, 2002).", "DNA damaged cells are not detected as live by growth assays, though they can express activity (Davey, 2011; Hammes et al., 2011; Villarino et al., 2003); explaining the contradicting results from FCM and plate count analysis.", "Plate count and MPN analysis are based on reproductive capacity and one could expect these growth assays to give comparable results.", "However, the results obtained by the MPN were similar to the plate count results in exp-II and to FCM in exp-I.", "This illustrates the challenge of getting reproducible results when analyzing UV irradiated organisms with methods that analyze different cellular characteristics.", "Further, growth assays may introduce errors as a majority of the microbes are uncultivable (Roszak and Colwell, 1987; Staley and Konopka, 1985).", "In addition, the MPN positive growth was determined by the eye, though fluorometry determination would have been a more objective analysis method and could potentially have given a slightly different outcome.", "However, the MPN method was validated by another researcher and by microscopy.", "The FCM results showed that inactivation increased with the time of dark incubation.", "Phytoplankton are photosynthetic organisms requiring light as an energy source (McMinn and Martin, 2013) and dark incubation will naturally affect their viability over time (Gollasch and David, 2010), especially if the cells continue with unchanged activity causing them to run out of energy (Jochem, 1999).", "Additionally, incubation in darkness will limit photoreactivation; the repair mechanism which removes UV induced DNA lesions and reverses damages by using the energy of light (Sinha and Häder, 2002), leaving the cells unrepaired and dying.", "Other studies have reported limited or no photoreactivation in UV irradiated Escherichia coli during incubation at darkness (Oguma et al., 2001; Yin et al., 2015; Zimmer and Slawson, 2002).", "In agreement with other studies the control samples contained reproducible cells even after 3 weeks of dark incubation (Gollasch and David, 2010; Olsen et al., 2015).", "T. suecica's ability to survive in darkness over time implies it does not overrate effects of UV treatments and makes it an appropriate indicator organism for ballast water monitoring.", "Some of the variation on results between exp-I and -II, such as variation in the stained controls day 1, difference in inactivation rate when irradiated with doses ≤ 200 mJ/cm2, large standard deviations and more cells in treated samples than in untreated ones, indicates that the algal culture used in exp-I contained a greater portion of fresh and healthy cells than the culture used in exp-II.", "Natural sea water shows great variability and contains a diverse community of algae species in different cellular phases varying with time and space and may have different tolerance and response to the same UV doses applied (Rastogi et al., 2010; Sinha et al., 1998; Xiong et al., 1997).", "Although not intentionally, our study indeed demonstrated that the UV treatment/dark incubation required for inactivation is dependent on the status of the ballast water inhabiting organisms.", "Therefore, our results imply that organisms in ballast water treated with UV doses 100–200 mJ/cm2 are inactivated when left in dark ballast tanks over a period of time.", "Our results also demonstrate the challenge of giving recommendations regarding duration of dark incubation needed for inactivation when using lower UV doses.", "It is, however, important to keep in mind that controllable experiments in a laboratory differ from a flow-through chamber in a commercial BWTS and that a BWTS comprise two or more treatment stages, enhancing the inactivation efficiency.", "Other factors can, however, also influence the inactivation efficiency in a BWTS, like biotic and abiotic particles in the sea water protecting the microbes during UV irradiation (Hess-Erga et al., 2008; Tang et al., 2011) and a BWTS has to be optimal under the prevailing circumstances whatever factors exist that may prevent inactivation.", "UV irradiation as a treatment technology has been criticized due to the uncertainty regarding inactivation at discharge but is more environmental friendly than chemical disinfection and creates no harmful by-products (Jung et al., 2012).", "In addition, UV irradiation represents little risk for the operators and less training is required to run the systems (International Maritime Organization, 2008b).", "This study was performed in a laboratory with cultures of T. suecica and with the MP UV lamp as the sole treatment source.", "For future studies it would be of interest to do experiments with T. suecica in real BWTS with MP UV technology.", "Such studies would improve our ability to give recommendations regarding UV doses and duration of dark incubation of T. suecica.", "To evaluate whether our FCM protocol is applicable to other microbes, laboratory studies should be performed with natural sea water irradiated with different UV doses.", "If analysis of natural sea water is feasible with our FCM protocol, the experiment needs to be repeated in a BWTS to evaluate inactivation in a system where it is intended to be used.", "The microbial community in ballast water is very diverse and organisms will vary with season, location and environmental conditions.", "The level of metabolic activity can vary between various algae species, and the response to environmental changes and inactivation treatments can differ (Jochem, 1999, 2000; Olsen et al., 2015).", "Although there are indications that the majority of phytoplankton species can be detected by the esterase substrates fluorescein diacetate (FDA) and 5-chloromethylfluoorescein diacetate (CMFDA) (Peperzak and Brussaard, 2011), we are therefore aware that fluorescing signal from esterase substrates can vary over a large range of intensities (Dorsey et al., 1989).", "Our recommendation at this point is thus to treat the ballast water with UV doses close to 400 mJ/cm2 in order to permanently inactivate the organisms.", "The variable results for UV doses 100–200 mJ/cm2 demonstrate the challenge of giving unambiguous recommendations on duration of dark incubation needed for inactivation." ]

[ "Response of T. suecica to different UV doses and dark incubation was determined.", "Flow cytometry and standard culturing methods were used to determine inactivation.", "Inactivation increased with increasing doses and with time of dark incubation after treatment.", "UV doses ≥ 400 mJ/cm2 permanently inactivated the algae.", "It is a challenge to give advices on dark incubation times for UV doses ≤ 200 mJ/cm2." ]

[ "MULT" ]

[ "Bioengineering", "Biotechnology", "Chemical engineering", "Komagataella phaffii", "Pichia pastoris", "Transaminase", "Whole cell biocatalyst" ]

[ "1000" ]

[ "The unicellular methylotrophic yeast Komagataella phaffii (K. phaffii), formerly known as Pichia pastoris (Kurtzman, 2009), is a well-established platform for heterologous protein production (Byrne, 2015; Macauley-Patrick et al., 2005).", "The initial genome sequence of K. phaffii (De Schutter et al., 2009; Küberl et al., 2011) has been further refined and annotated (Sturmberger et al., 2016), supporting the development of genetic tools for its manipulation (Ahmad et al., 2014; Vogl et al., 2016).", "K. phaffii can grow to very high cell densities, exceeding 150 g L−1 of dry cell weight, using inexpensive and simple media and carbon sources.", "Abad et al. (2010) demonstrated the effectiveness of K. phaffii as a whole cell biocatalyst by showing that cells engineered to express Trigonopsis variabilis D-amino acid oxidase could be used effectively for D-amino acid oxidation.", "Wei et al. (2018) engineered K. phaffii strain GS115 to overexpress a native transketolase and in whole cell biocatalysis the resultant strain achieved high yields of the chiral sugar L-erythrulose from prochiral substrates.", "Bea et al. (2010) showed that K. phaffii cells engineered to express an ω-transaminase from Vibrio fluvialis strain JS17 achieved kinetic resolution of racemic α-methylbenzylamine mixture to an enantiomeric excess of 99% (R)-α-methylbenzylamine.", "The ω-transaminase designated CV 2025 (Kaulmann et al., 2007) from Chromobacterium violaceum (C. violaceum) has shown promising results in the production of chiral amino-alcohols, such as 2-amino-1,3,4-butanetriol (ABT), using bacterial whole cells (Ingram et al., 2007; Rios-Solis et al., 2015).", "ABT is a key synthon in the production of many small molecule drugs (Ager et al., 1996; Sehl et al., 2015), including protease inhibitors (Kwon and Ko, 2002) and antiretrovirals (Raghavan et al., 2010).", "Bioconversion using ω-transaminases, either purified (Heintz et al., 2017) or within whole cells (Shin and Kim, 1999; Slabu et al., 2017; Gomm and O'Reilly, 2018) has also been used for production of chiral amines, another class of synthon utilised extensively in synthesis of bioactive natural products, agrochemicals and active pharmaceutical ingredients (Kelly et al., 2018).", "In this work, we engineered the K. phaffii strain BG-10, available commercially from ATUM, to overexpress the bacterial transaminase CV2025 in the new strain, designated BG-TAM.", "We established the growth performance of the BG-TAM strain and tested its whole-cell biocatalytic production of both the chiral amino alcohol ABT, and the chiral amine 1-methyl-3-phenylpropylamine (MPPA), when fed low-cost substrates.", "Komagataella phaffii strain BG-10 and plasmid pJ902-15 were purchased from ATUM.", "K. phaffii biomass concentration was measured as optical density at 600 nm (OD600) using a spectrophotometer.", "The C. violaceum CV2025 ω-transaminase gene (NCBI sequence reference WP_011135573.1) was obtained from GenScript.", "Zeocin was purchased from Thermo Fischer Scientific.", "The C. violaceum CV2025 gene was codon-optimised for expression in K. phaffii using the OptimumGene™ algorithm by GenScript.", "The optimised coding sequence is available as a public data set (Braun-Galleani et al., 2018).", "The 1.4 kb CV2025 gene was flanked by BsaI sites enabling subcloning into a lone BsaI site present in pJ902-15 to generate the new, 4.9 kb plasmid, pJ-CV2025.", "BG-10 cells were transformed using 20 μg of SacI-linearised pJ-CV2025 by electroporation (1500 V, 200 Ω, 25 μF) and subsequently plated onto YPD agar plates supplemented with 1 M sorbitol and 200–1000 μg mL−1 of zeocin to select for stable integrants.", "Colony PCR was used to confirm the presence of integrated pJ-CV2025 in the AOX1 locus in zeocin-resistant colonies using the primer, CCAAAGACGAAAGGTTGAATG, which was designed to anneal within the AOX1 promoter and the primer, GATAATTCGACAACAGCAGG, designed to anneal within the codon-optimised C. violaceum CV2025 gene at a position predicted to be 300 base pairs downstream of the AOX1 promoter only in transformants.", "Transformant colonies, which were both zeocin resistant and positive by colony PCR, were designated ‘BG-TAM’ and a master cell bank of clones was generated and cryopreserved at -80 °C.", "K. phaffii BG-10 and BG-TAM strains were grown for 18 h in 250 mL baffled flasks at 30 °C with 250 rpm to an OD600 ∼ 10 in 50 mL of BMGY medium (1% w/v yeast extract, 2% w/v peptone, 100 mM pH 6.0 potassium phosphate buffer, 0.4 μg mL−1 biotin, 1% v/v glycerol and 1.34% v/v yeast nitrogen base), a base medium for preparation of minimal and synthetic defined yeast media.", "Cells were harvested by centrifugation at 5,000 rpm and 4 °C for 5 min, washed in phosphate buffer and resuspended in 50 mL BMMY medium (same constituents as BMGY but substituting 1% v/v glycerol for 2% v/v methanol) to an OD600 = 5.", "2% v/v methanol was added every 24 h to maintain induction of the AOX1 promoter.", "Samples were harvested after 48 h of induction and used for bioconversion measurements.", "Cultivation in bioreactor was performed using a Multifors 1L device (INFORS HT).", "The Multifors 1L device has been reported previously to achieve OD600 in the range of 800–1000 and DCW of 150–200 g L−1 during K. phaffii cultivation by Templar et al. (2016) and Wei et al. (2018) respectively.", "For a starter culture, 150 mL BMGY in a 1 L baffled flask was inoculated with a 1.5 mL cryostock, and incubated at 30 °C and 250 rpm, until an OD600 = 60 was reached.", "This was used as inoculum for 600 mL of basal salt medium (BSM: 1 L with RO water with 26.7 mL 85% w/v H2PO4, 0.93 g CaSO4, 18.2 g K2SO4, 14.9 g MgSO4·7H2O, 4.13 g KOH, 40 g glycerol and 12 mL of ‘Pichia Trace Metal 1’ (PTM1) solution.", "PTM1 had the following constituents: 6.0 g L−1 CuSO4·5H2O, 0.08 g L−1 Nal, 3.0 g L−1 MnSO4·H2O, 0.2 g L−1 Na2MoO4·2H2O, 0.02 g L−1 H3BO3, 0.5 g L−1 CoCl2, 20.0 g L−1 ZnCl2, 65.0 g L−1 FeSO4·7H2O, 0.2 g L−1 biotin and 5.0 mL L−1 of 96% v/v H2SO4.", "Cultivation parameters and methanol induction conditions followed Invitrogen guidelines for Pichia fermentation (Invitrogen, 2002) with cultivation conditions of 30 °C, pH 5.0 and dissolved oxygen kept above 20% by increasing agitation speed or pure oxygen sparging.", "Briefly, cultivation was performed in batch mode for ∼18 h, until glycerol was completely consumed, and subsequently switched to a glycerol fed-batch regime (50% w/v glycerol feed containing 12 mL L−1 PTM1 trace salts, 18.15 mL h−1 L−1 initial fermentation volume) for 6 h, followed by a methanol fed-batch phase using 100% methanol supplemented with 12 mL L−1 PTM1 trace salts at the following feed rates: 3.6 mL h−1 L−1 for 1 h (M1), 7.3 mL h−1 L−1 for 2 h (M2), and final feed rate of 10.9 mL h−1 L−1, which was maintained for 48 h. Samples for growth rate monitoring were harvested at t = 0 and t = end of each feeding phase.", "The measurement of dry cell weight was carried out by putting the cell pellet of 1 mL of culture in an oven (100 °C) and measuring weight in an analytical balance every 24 h until constant (∼96 h).", "Samples for bioconversions were harvested after the initial batch stage and every 24 h after methanol induction, the supernatant removed and the cell pellet stored at -20 °C.", "All bioconversion reactions were carried out in 900 μL final volume using whole cells at 30 °C and 500 rpm in a thermomixer (Eppendorf ThermoMixer® C).", "Pelleted shake flask and bioreactor samples were thawed and re-suspended to 600 μL in a pH 7.5 solution of 0.2 mM pyridoxal phosphate (PLP) in 200 mM, 4-(2-hydroxyethyl)-1-piperazineethanesulfonate (HEPES) buffer to allow the PLP cofactor to associate with transaminase within cells.", "These cell suspensions were then incubated in 1.5 mL glass vials for 20 m, followed by the addition of 300 μL of substrate solution, consisting of 200 mM HEPES buffer pH 7.5, 0.2 mM pyridoxal phosphate and substrate levels needed to provide the final concentrations indicated in the Results section.", "Aliquots of 100 μL were taken from the bioconversion reactions at different time points, centrifuged at 12,000 rpm for 10 m at 4 °C, before the supernatant was removed, retained and stored at -20 °C for further analysis.", "An integrated Dionex Ultimate 3000 HPLC system fitted with an ACE 5 C18 reverse phase column (150 mm × 4.6 mm, 5 μm particle size) controlled by Chromeleon 7 software (Thermo Fisher Scientific) was used to quantify MBA, ACP, PB, MPPA and ABT.", "Samples were quenched and diluted with 0.1% v/v TFA prior to analysis.", "To analyse MBA and ACP, two mobile phases were used: 100% acetonitrile (A) and 0.1% (v/v) trifluoroacetic acid (B).", "A gradient was run from 15% A/85% B to 72% A/28% B over 9 min, followed by a re-equilibration step for 2 m (oven temperature 30 °C, flow rate 1 mL/min).", "UV detection was carried out at 260 nm, with detection times of 3.6 m for MBA, and 7.8 m for ACP.", "For MPPA and PB analysis, two mobile phases were used: 0.1% (v/v) trifluoroacetic acid (C) and 0.095% trifluoroacetic acid/80% acetonitrile in MilliQ water (D).", "A gradient of 40% C/60% D to 100% D was run over 15 min, followed by 2.5 m wash with 100% D, and a subsequent re-equilibration step for 2.5 m (oven temperature 30 °C, flow rate 1 mL/min).", "UV detection was carried out at 254 nm, with retention times of 2.7 m for MPPA, and 7.7 m for PB.", "For ABT measurement, 6-aminoquinolyl-n-hydroxysuccinimidyl carbamate (AQC) was used as derivatization agent.", "AQC, provided by Dr Fabiana Subrizi from UCL Department of Chemistry, was solubilized in dry acetonitrile (10 mg mL−1) and stored in dry conditions for no longer than 2 weeks.", "Typically, a volume of 75 μL of AQC solution was added to 150 μL of bioconversion supernatant previously diluted in 0.02 M borate buffer pH 8.8, reaching a final volume of 225 uL.", "This mixture was centrifuged prior to analysis.", "To analyse ABT, two mobile phases were used: 140 mM sodium acetate, pH 5.05 (E) and 100% acetonitrile (F).", "A gradient of 85% E/15% F to 100% F over 10 m (flow rate 0.5 mL min−1), followed by a 2.5 m wash with 40% E/60% F and a 2.5 m wash with 100% E (flow rate 1 mL min−1).", "A re-equilibration step was run for 5 min.", "UV detection was carried out at 254 nm, with a retention time of 6.1 min.", "For quantification of ERY, an Aminex HPX-87H reverse phase column (300 × 7.8 mm, Bio-Rad, USA) was used.", "The system was run at 60 °C with 0.6 mL min−1 isocratic flow of 0.1% trifluoroacetic acid as mobile phase.", "UV Detection was carried out at 210 nm with a retention time of 11.5 min.", "The molar extinction coefficient (ε) at wavelength of 260 nm was determined to be 4878.05 M−1 cm−1 for MBA and 4405.29 M−1 cm−1 for ACP.", "At 254 nm ε was determined to be 171.32 M−1 cm−1 for PB, 168.86 M−1 cm−1 for MPPA and 2890.17 M−1 cm−1 for derivatised ABT.", "We tested whether transaminase overexpression impacted the growth characteristics of K. phaffii strain BG-TAM, given that endogenous transaminases form part of the native metabolic networks of the organism.", "BG-TAM and BG-10 strains were each cultivated in the presence of up to 5% v/v methanol.", "The BG-TAM growth profile (Fig. 1a) did not deviate markedly from that of the parental strain BG-10 (Fig. 1b).", "The highest concentration of 5% v/v methanol suppressed growth in both strains, whereas 2% v/v provided the best results for cell density and growth rate.", "This methanol concentration was used subsequently for induction in the shake flask experiments of this study.", "BG-10 and BG-TAM cells were cultivated in shake flasks in the presence of 2% v/v methanol for 48 h. Harvested cells were diluted or concentrated to a normalised concentration of OD600 = 39, for purposes of comparison, and incubated with substrates to assess whole cell biocatalytic activity for production of ABT and MPPA by the pathways illustrated in Fig. 2a and b, respectively.", "When cells of the BG-TAM were incubated with 10 mM MBA and 30 mM ERY, production of ACP was observed, whereas under the same conditions cells of the parental BG-10 strain resulted in no ACP production (Fig. 2c).", "We interpreted this observation as further evidence that the plasmid pJ-CV2025 had integrated at the AOX1 locus as intended and that expression of the codon-optimised CV2025 gene was responsible for the observed ACP accumulation.", "Shake flask-cultivated BG-TAM cells were prepared as above for bioconversion of MBA and ERY to ABT and also for bioconversion of MBA and PB to MPPA.", "Both bioconversions showed activity, with production of around 4mM product for both ABT (Fig. 2d) and MPPA (Fig. 2e).", "BG-TAM and parental BG-10 strain cells were cultivated in a 1L bioreactor comprising firstly a glycerol batch and fed-batch feeding to achieve high biomass, followed by fed-batch methanol feeding to induce the AOX1 promoter that controls expression of the transgene.", "Under this cultivation regime, the unmodified parental BG-10 strain and the engineered BG-TAM strain achieved cell densities of OD600 ∼ 900–1000, after 48 h of methanol induction.", "The growth profile illustrated in Fig. 3 shows cell biomass accumulation data from three cultivations performed in parallel using the Multifors 1L bioreactor system.", "Growth of the engineered BG-TAM strain was comparable to that of the unmodified strain, with matching levels of final biomass achieved at harvest.", "Given that the strains also showed similar growth performance during shake flask cultivation (Fig. 1), under methanol induction, we concluded that overexpression of the CV20205 transaminase gene in BG-TAM did not considerably perturb viability of the BG-TAM strain relative to the parental strain.", "Bioreactor-cultivated BG-TAM cells were harvested after 66 h of methanol induction (92.5 h post inoculation) when an OD600 = 1024 was achieved (final time point, Fig. 3).", "We then mapped the limits of substrate concentration that high cell density suspensions of BG-TAM cells could tolerate whilst maintaining bioconversion.", "We measured bioconversion achieved by cells incubated with 10–30 mM substrate, the concentrations we had used for shake flask samples, and then increased substrate concentration to 100 mM and finally to 0.5 M (Fig. 4).", "A concentration of 0.5 M MBA and ERY abolished production of both ACP (Fig. 4a) and ABT (Fig. 4b), establishing an upper limit on the performance of the whole cells for this reaction.", "By contrast, the whole cell biocatalyst retained a level of activity in 0.5 M substrates PB and MBA, producing 2.82 mM MPPA.", "We concluded from these observations that the upper limit for substrate tolerance for the ABT reaction is not due solely to general stress of the enzyme or living cells but is in part substrate-specific.", "At a concentration of 100 mM, all substrates were well-tolerated and resulted in the highest observed bioconversion levels of 11.48 mM for ABT, and 29.6 mM for MPPA (Fig. 4).", "The data in Fig. 4 suggest future investigations would be warranted to map biocatalysis performance for substrate concentrations between 0.1 M and 0.5 M.", "Schrewe et al. (2013) proposed a battery of performance measures best suited to whole cell biocatalysts, which could be useful for researchers or industrialists across a range of different process configurations and needs.", "In Table 1 we collated the performance metrics for BG-10 strain whole cells used in the three best-performing conditions, with respect to product concentration, observed in Fig. 4.", "Table 1 shows that BG-10 whole cells achieved a best yield on substrate (Yp/s) of 0.41 mol mol−1 (molproduct molsubstrate−1), which is comparable to the Yp/s of 0.52 mol mol−1 reported by Wei et al. (2018) for whole cell biocatalysis using a K. phaffii strain engineered to overexpress transketolase, an enzyme type that typically exhibits high activity in bioconversions.", "As ω-transaminases have been shown to be responsive to mutational approaches to increase their performance (Deszcz et al., 2015), the performance data reported here with an unmodified ω-transaminase certainly encourages further investigation of whole cell applications.", "Stephanie Braun-Galleani: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.", "Maria-José Henríquez: Contributed reagents, materials, analysis tools or data.", "Darren N. Nesbeth: Conceived and designed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.", "This work was supported by the UK BBSRC grant BB/M004880/1 within the ERA-NET IPCRES consortium, and CONICYT-Becas Chile (Folio no. 72120390).", "The authors declare no conflict of interest.", "No additional information is available for this paper." ]

[]

[ "MULT" ]

[ "Fluid intelligence", "Independent component analysis", "Individual differences", "Neuroanatomy", "Tractography" ]

[ "1000" ]

[ "The data (Supplementary Table 1) includes cognitive and anatomical variables collected prior to a large, multi-modal cognitive training study [25].", "They include:", "Demographic measures (i.e., age, sex, and education).", "4 cognitive factors estimated via structural equation modeling [15].", "Scores from the battery of 12 cognitive tests used to estimate these factors.", "35 cortical thickness estimates and volume estimates for these same regions.", "11 sub-cortical volumetric estimates.", "Total brain and total intracranial volume estimates.", "7 estimates of ventricular size.", "5 estimates of corpus callosum.", "12 estimates of fractional anisotropy and in matter tracts.", "12 estimates of radial diffusivity in white matter tracts.", "The 190 participants consisted of 85 females, and 105 males.", "The age range in our sample was 18–44 years, with a median of 22 years, and a mean of 24.3 years.", "The mean educational level of the participants was “some college” (i.e., median score 3, mean score 3.6) as reported on a scale from 1 to 5, where 1 denoted “less than a high school diploma”, 2 denoted “high school diploma or equivalent”, 3 denoted “some college”, 4 denoted “college degree”, and 5 denoted “post-graduate education.”", "Maximal oxygen consumption (VO2max) was measured using a computerized indirect calorimetry system (ParvoMedics True Max 2400) and a modified Balke protocol [1] with averages for oxygen uptake (VO2) and respiratory exchange ratio (RER) assessed every 20 s. Participants ran on a motor-driven treadmill at a constant speed, with 2.0% increases in grade every two minutes until volitional exhaustion.", "The raw value was adjusted for body size, age, and gender to produce a VO2max percentile score.", "Participants received a battery of 12 cognitive tests designed to estimate underlying latent variables corresponding to cognitive constructs (see Table 1).", "The four latent variables of interest were fluid intelligence (gf), working memory (wm), executive function (ef), and episodic memory (em).", "Each of these latent variables was measured with three cognitive tests as follows.", "Fluid intelligence (gf) was measured by the BOMAT, number series, and letter sets tests [3,4,7].", "Working memory (wm) was measured by the reading, rotation, and symmetry span tests [8,23].", "Executive function (ef) was measured by the Garavan, Keep Track, and Stroop tests [14,22,26].", "Episodic memory (em) was measured by immediate free recall, words, pictures and paired associates tests [23,24,9].", "Using a structural equation modeling approach [15], across the larger sample of 518 participants, we extracted estimates of the four cognitive construct latent variables (i.e., gf, wm, ef, em).", "Because Garavan and Stroop produce error scores, while all others are measures of accuracy, we inverted these two values (i.e., multiplied by −1) in order to ensure all cognitive variables had the same sign.", "High resolution T1-weighted brain images were acquired using a 3D MPRAGE (Magnetization Prepared Rapid Gradient Echo Imaging) protocol with 192 contiguous axial slices, collected in ascending fashion parallel to the anterior and posterior commissures, echo time (TE)=2.32 ms, repetition time (TR)=1900 ms, field of view (FOV)=230 mm, acquisition matrix 256 mm×256 mm, slice thickness=0.90 mm, and flip angle=9°.", "All images were collected on a Siemens Magnetom Trio 3T whole-body MRI scanner.", "Automated brain tissue segmentation and reconstruction of the T1-weighted structural MRI images were performed using the standard recon-all processing pipeline in FreeSurfer, version 5.2.0 (Released May, 2013; http://surfer-nmr.mgh.harvard.edu/).", "This produced estimates of 1) cortical thickness, 2) cortical volumes, 3) sub-cortical volumes, 4) ventricles, and 5) corpus callosum [5,6,10–13].", "Segmentations and tractography were manually checked for errors.", "Estimates in the left and right hemispheres were summed to produce bilateral estimates, and all values were converted to z-scores to control for differences in scale.", "A complete list of estimated structures appears in Table 1.", "FreeSurfer produced automated segmentation that closely approximates hand tracing, but like all segmentation procedures may introduce systematic bias.", "The diffusion tensor imaging estimates for fractional anisotropy (FA) and radial diffusivity (RD) data was analyzed using tract-based spatial statistics in FSL [19–21].", "This pipeline involves fitting a tensor model to the raw diffusion data using fMRIDB׳s diffusion toolbox, and non-brain tissues were removed using FSL׳s brain extraction tool.", "All subjects׳ FA data were then aligned into a common space using the nonlinear registration tool FNIRT [18,2].", "Next, the mean FA image was created and thinned to create a mean FA skeleton that represents the centers of all tracts common to the group.", "Each subject׳s aligned FA data was then projected onto this skeleton to create an estimate of the subject-level value associated with each tract." ]

[]

[ "BIOC" ]

[ "Neonatal hypoxic/ischemic encephalopathy", "Oligodendrocyte precursor cells", "PARP inhibitors", "Remyelination" ]

[ "1307", "1309" ]

[ "Oligodendrocytes, the cells wrapping the axons of the central nervous system (CNS) with the myelin sheath, derive from the oligodendrocyte precursor cells (OPCs) generated during development from multipotent neuroectodermal derivatives in the cortex and spinal cord (Bergles and Richardson, 2015).", "These cells proliferate and migrate to populate the entire adult CNS, where they account for approximately 5–8% of the entire cell population (Dawson et al., 2003).", "New OPCs can be also generated in the adult CNS from neural stem cells (NSCs; Agathou et al., 2013) and by mitosis, as OPCs are the major proliferating population of the CNS under appropriate stimuli (Fernandez-Castaneda and Gaultier, 2016).", "These cells are responsible for myelin formation during development (Bergles and Richardson, 2015), and for myelin turnover and repair during adulthood (Young et al., 2013).", "The process of myelin formation is highly orchestrated in time and space, involves different cell types, and a key step of this process is the OPC maturation toward myelinating oligodendrocyte (Zuchero and Barres, 2013).", "Internal and external cues targeting genetic, epigenetic and cytoplasmic mechanisms provide the appropriate microenvironment that regulates the molecular machinery triggering OPCs out of the cell cycle to terminal differentiation (Zuchero and Barres, 2013; Liu et al., 2016; Fernández et al., 2016).", "It has been suggested that remyelination after lesions in the adult CNS recapitulates developmental myelination (Franklin and Hinks, 1999).", "However, substantial differences could well be expected between a normal turnover process and a repair process (Fancy et al., 2011) triggered by pathological events like inflammation and hypoxic/ischemic damage.", "These events actually mobilize a large number of inhibitory factors leading to a differentiation block of OPC (Gaesser and Fyffe-Maricich, 2016).", "Thus, there is an urgent need to more clearly elucidate the molecular bases of the relationship between OPCs proliferation and differentiation, carefully dissecting developmental myelination vs. myelin turnover in adulthood, and physiological vs. pathological conditions.", "In the present study, we investigated the role of poly(ADP-ribose) polymerases (PARPs) in OPCs survival, proliferation and differentiation.", "PARPs are members of nuclear enzyme family that catalyse the formation of (ADP-ribose)n chains from NAD+ on acceptor proteins after DNA double strands breaks (Amé et al., 2004).", "Because of the PARPs well described role in DNA repair and apoptosis induction (Heeres and Hergenrother, 2007), PARPs inhibition is currently considered a therapeutic option for cancer, including glioblastoma (Curtin and Szabo, 2013).", "Moreover, PARPs inhibition was proposed as a neuroprotective strategy for neonatal asphyxia and hypoxia/ischemia encephalopathy (Neira-Peña et al., 2015), a CNS injury that occurs during a critical period of developmental myelination (Dimou and Götz, 2014).", "In order to study the effect of PARP inhibition in all stages of differentiation, from NSCs to mature oligodendrocytes, we used OPCs-enriched cultures obtained from the fetal forebrain- and the adult sub-ventricular zone of the mouse to study the different role of PARPs in adult and fetal OPCs differentiation and maturation.", "We used PARP inhibitors having a different inhibitory concentration as pharmacological toll, including the clinically approved Olaparib (LYNPARZA™).", "All animal protocols described herein were carried out according to the European Community Council Directives (86/609/EEC), and comply with the guidelines published in the NIH Guide for the Care and Use of Laboratory Animals.", "Fetal and adult NSCs were isolated from E.13–14 fetal mouse forebrain or 2.5 month old mice sub-ventricular zone (SVZ), following the Ahlenius and Kokaia protocol (Ahlenius and Kokaia, 2010).", "Oligodendrocyte differentiation was performed following the Chen protocol (Chen et al., 2007) with some modifications.", "Tissues were enzymatically dissociated using trypsin (SIGMA), hyaluronidase (SIGMA) and DNase (SIGMA), than mechanically dissociated by piepetting.", "The solution was filtered, centrifuged and the resulting pellet was washed twice in HBSS.", "After 7 min centrifugation at 400 × g, the cellular pellet was resuspended in serum-free medium (DMEM/F12 GlutaMAX 1 ×; 8 mmol/L HEPES; 100 U/100 μg Penicillin/Streptomycin; 0.1 × B27; 1 × N-2; 20 ng/ml bFGF; 20 ng/ml EGF) and, after cell count, cells were plated in suspension at a density of 10 cells/μl in a final volume of 3 ml in low-attachment 6-well plates (NUNC).", "Half medium was changed every three days, centrifuging the cell suspension at 300 × g for 5 min and gently resuspending the cellular pellet in fresh medium.", "Neurospheres were allowed to proliferate until they attained a diameter of about 100 μm.", "To obtain oligospheres, primary neurospheres were centrifuged at 300 × g for 5 min.", "The pellet was mechanically dissociated by pipetting and cells were counted and plated again at a density of 10 cells/μl in a final volume of 3 ml of OPCs medium (DMEM/F12 GlutaMAX 1 ×; 8 mmol/L HEPES; 100 U/100 μg Penicillin/Streptomycin; 0.1 × B27; 1 × N-2; 20 ng/ml bFGF; 20 ng/ml PDGF) in low-attachment 6-well plates (NUNC).", "Oligospheres were centrifuged and the pellet was mechanically dissociated to obtain a single cell suspension.", "After cell count, cells were plated at a density of 3000 cells/cm2 on poly-d,l-ornithine (50 μg/ml)/laminin (5 μg/ml) coating, in OPC medium.", "In order to induce oligodendrocyte differentiation and maturation, after 3 DIVs OPC medium was replaced with the oligodendrocyte differentiation medium (DMEM/F12 GlutaMAX 1 ×; 8 mmol/L HEPES; 100 U/100 μg Penicillin/Streptomycin; 0.1 × B27; 1 × N-2; 50 nM T3; 10 ng/ml CNTF; 1 × N-acetyl-l-cysteine-NAC-).", "The following PARPi (PARP inhibitors) were used in this study: TIQ-A (IC50 140–450 nM), PJ34 (IC50 20 nM) and Olaparib (IC50 5 nM; Ferraris, 2010; Hans et al., 2011).", "OPCs were treated 24 h before the T3-mediated differentiation induction (− 1 DIV), and cell viability was analysed at DIV 12 of differentiation (Fig. 1A).", "In order to study effects of PARPi on fetal and adult cultures, different treatment were performed: i) in order to study PARP1–2 expression and PARP activity, cells were analysed 24 h after treatment (DIV 0; Fig. 1A); ii) a dose-response curve of PARPi were performed, treating cultures with a series of 7 concentrations (0–10 μM).", "PARPi treatments were maintained after the oligodendrocyte differentiation medium change, until DIV 12 (Fig. 2A); iii) fetal cultures were also treated with PJ34 10 μM and analysed for cell number and cell death at DIV 0, 6 and 12 (Fig. 3A); iv) both fetal and adult cultures were treated with lower dose of PARPi (1 μM and 10 μM) and analysed for mature oligodendrocytes at DIV 12 (Fig. 4A).", "Indirect immunofluorescence was used to identify OPCs (NG2-positive cells), mature (CNPase-positive cells) and myelinating (MBP-positive cells) OLs, neurons (β-III-tubulin-positive cells) and astrocytes (GFAP-positive cells).", "The following primary antisera were used: mouse anti-β-III-tubulin (R&D system, Trento, Italy) 1:3000; rabbit anti-GFAP (Glial Fibrillary Acidic Protein, Dako) 1:1000; rabbit anti-NG2 (chondroitin sulphate proteoglycan, neural/glial antigen 2, Millipore, Merck S.p.a., Milan, Italy) 1:350; mouse anti-CNPase (2′, 3′-cyclic nucleotide 3′-phosphodiesterase, Millipore) 1:500; rabbit anti-MBP (Myelin Basic Protein, Dako) 1:500.", "Donkey Alexa 488-conjugated anti mouse and donkey Alexa 568-conjugated anti-rabbit (Invitrogen) were used as secondary antisera.", "After immunofluorescence staining, cells were incubated with the nuclear dye Hoechst 33,258 (1 μg/ml in PBS, 0.3% Triton-X 100) for 20 min at RT.", "Cells were finally washed in PBS and mounted in glycerol and PBS (3:1, v/v) containing 0.1% paraphenylendiamine.", "For HCS analysis cells were grown in 96 flat-bottom well HCS plates (NUNC).", "Analysis of condensed nuclei, cell number and lineage/differentiation markers were performed with Cell Insight™ CX5 High Content Screening (HCS; Thermo Scientific), using the Compartmental analysis BioApplication.", "Based on nuclear staining, the software is able to recognise nuclei and calculate the percentage of high intensity/small sized condensed nuclei.", "Moreover, based on the nuclei identification, the software is able to detect the presence of the marker-specific stain in the cell body, calculating the percentage of the immunoreactive cells.", "Lineage/differentiation markers analysis was performed only on cells showing intact nuclei, excluding condensed nuclei from the percentage calculation.", "Total RNA isolation was performed by using the RNeasy Mini kit (Qiagen, Milan, Italy) following manufacturer's instructions.", "Total RNA was eluted in RNase Free Water and concentration estimated through absorbance values at 260, 280 and 320 (Nanodrop 2000 spectrophotometer, Thermo Scientific).", "First strand cDNAs were obtained using the iScript™ cDNA Synthesis Kit (BioRad), incubating samples at 42 °C for 30 min.", "An RNA sample with no reverse transcriptase enzyme in the reaction mix was processed as a no-reverse transcription control sample.", "Semi-quantitative real-time PCR was performed using the CFX96 real-time PCR system (BioRad, CA, USA).", "The reactions were performed in a final volume of 20 μl consisting of 1 × SYBR Green qPCR master mix (BioRad) and 0.4 μM forward and reverse primers.", "In order to avoid possible contamination of genomic DNA in isolated RNA, the no-reverse transcriptase sample was processed in parallel with the others and tested by real-time PCR for every pair of primers used.", "All primers used were designed using Primer Blast software (NCBI, MD, USA) and synthesised by IDT (Coralville, IA, USA).", "The following primer sequences were used: PARP-1 (FW: 5′-GCCACACATCTCAGGGAGAC-3′; REV: 5′-CCCAAACCTTTGACACTGTGC-3′), PARP-2 (FW: 5′-GAAGGACGCAGACAGGACAA-3′; REV: 5′-ACATGAGCCTTTCCCAGCTT-3′).", "GAPDH (FW: 5′-GGCAAGTTCAATGGCACAGTCAAG-3′; REV: 5′-ACATACTCAGCACCAGCATCACC-3′) was used as housekeeping gene to normalize the amount of reverse-transcribed RNA used for PCR.", "Thermal profile of PCR reactions consisted first of a denaturation step (95 °C, 2 min) and 40 cycles of amplification (95 °C for 15 s and 60 °C for 60 s).", "At the end of the amplification cycles the melting curve of amplified products was performed according to the following temperature/time scheme: heating from 55 °C to 95 °C with a temperature increase of 0.5 °C/s.", "Primers efficiency values for all primers were 95–102%.", "The 2(− ΔΔCT) method was used for the calculation of gene expression.", "Fetal and adult OPCs at DIV 0, after 24 h of PARPi treatment, were lysed and proteins were quantified using the Lowry method (BioRad) following the manufacturer's instruction.", "PARP enzymatic activity was measured using HT Colorimetric PARP Apoptosis Assay Kit (Trevingen), following manufacturer's instructions.", "Data are reported as mean ± SD.", "Prism software (GraphPad) was used for statistical analyses and graph generation.", "Student's t-test or one-way ANOVA and Dunnett's multiple comparison post-hoc were used to analyse data.", "Results were considered significant when the probability of their occurrence as a result of chance alone was < 5% (P < 0.05).", "The cell systems used in this study are presented in Fig. 1.", "After cell expansion as neurospheres and oligospheres, cells were seeded for 3 DIVs in OPC medium, and then differentiated for 12 days in the presence of T3 (Fig. 1A).", "Lineage progression from NG2-positive OPC (DIV0) through CNPase-mature OL as far as myelinating MBP-positive OL is illustrated in Fig. 1C–E (representative images).", "The culture composition changes during the 12 DIV differentiation period, starting from DIV0, where the majority of cells are NG2 positive (NG2-positive cells 80%; CNPase-positive cells 5%), passing thorough DIV 6, where CNPase cells are growing in number (NG2-positive cells 60%; CNPase-positive cells 30%), reaching the end of the differentiation with CNPase/MBP positive cells representing the majority of cells.", "Culture composition at 12 DIV is presented in Fig. 1B. Adult cultures after 12 DIVs of differentiation show a less mature cell composition, with a high percentage of NG2-positive cells (P = 0.016) and less CNPase (P < 0.0001) and MBP (P = 0.008) positive cells.", "Fetal cultures show less astrocytes (GFAP-positive cells; P = 0.0023) and around 6% of neurons (β-III-tubulin positive cells) that are not detected in adult cultures (P = 0.002).", "In order to characterize the effect of PARP inhibition in fetal and adult OPCs on oligodendrocyte differentiation and maturation, cells were exposed to PARPi 24 h before differentiation induction (Fig. 1A).", "We first investigated the gene expression of the two major and more extensively studied PARPs, PARP-1 and 2 (Fig. 1F–G), and PARP activity (Fig. 1H), before the induction of differentiation, 24 h after PARPi treatment (DIV 0).", "Both genes are expressed in fetal (ΔCq = 3.28 ± 0.08) and adult (ΔCq = 5.79 ± 0.4) OPCs; gene expression is significantly higher in fetal compared to adult OPCs (PARP-1, P < 0.0001; PARP-2, P = 0.0002; Fig. 1F), and PJ34 treatment did not influence the mRNA expression levels (Fig. 1G).", "PARP activity analysis was based on the capability of PARP to parrylate histons in an ELISA-based assay.", "PARP activity was significantly higher in fetal OPCs compared to adult (P < 0.0001), and PJ34 treatment was able to decrease the activity in both cultures (fetal, P = 0.0005; adult P = 0.0284), thus confirming that the enzyme is active in both cell systems (Fig. 1H).", "In order to establish the cytostatic/toxic profile of PARPs inhibition on OPCs, we first constructed a dose-response curve on the cell culture which displayed the higher activity and expression of PARPs, i.e. fetal OPCs, using two standard PARPi, i.e. PJ34 and TIQ-A.", "The cytostatic effect is evaluated by the cell number (Fig. 2B), the cytotoxic effect by the percentage of condensed nuclei (Fig. 2C), as established by HCS in three independent experiments.", "The cytostatic effect was observed at 1 μM and 10 μM using TIQ-A (P < 0.0001); at 10 μM using PJ34 (P < 0.0001).", "Both molecules induced an increase in the percentage of condensed nuclei at the highest concentration (10 μM) according to the respective potency (TIQ-A, P < 0.0001; PJ34, P = 0.0362).", "We then investigated the effect of PJ34 and TIQ-A on adult OPCs using the toxic concentration for fetal OPCs (10 μM) finding that PJ34, but not TIQ-A, reduced the cell number in adult cultures (Fig. 2D; P = 0.0004) without affecting the percentage of condensed nuclei (Fig. 2E).", "We also tested the Olaparib, a clinically approved PARPi, showing the highest PARP inhibitory activity.", "Olaparib treatment caused a reduction in cell number in both fetal and adult cultures at low concentrations (Fig. 2F; 10− 1 nM; P < 0.0001) but is cytotoxic only for fetal OPCs (Fig. 2G; 101 nM; P < 0.0001).", "In order to better elucidate the timing of the PARP inhibition effect, we performed a time course analysis of cell number and cell death, by using PJ34 at a 10 μM toxic dose, (Fig. 3A).", "We found that after 24 h from the treatment there were no effects on cell number (Fig. 3B) and cell death (Fig. 3C).", "In vehicle treated cells, cell number increases over time, while in PARPi-treated cells remain at the same level for the whole differentiation period (Two Ways ANOVA, time F(2, 90) = 20.37, P < 0.0001; treatment F(1, 90) = 63.13, P < 0.0001; interaction F(2, 90) = 15.28, P < 0.0001), leading to a strong difference between the two groups at DIV 6 (P < 0.0001) and DIV 12 (P < 0.0001; Fig. 3B).", "In the opposite way, the percentage of condensed nuclei remain constant in the vehicle-treated, while increasing over time in the PARPi-treated group (Two Ways ANOVA, time F(2, 86) = 12.49, P < 0.0001; treatment F(1, 86) = 46.65, P < 0.0001; interaction F(2, 86) = 15.60, P < 0.0001), starting from DIV6 (P = 0.0003) and reaching > 30% at DIV 12 (P < 0.0001; Fig. 3C).", "We finally investigated the effect of PARP inhibition on the differentiation of remaining OPCs using the two highest concentrations, being either toxic or non-toxic.", "Fetal OPCs were treated with TIQ-A, PJ34 and Olaparib at 1 μM (non-toxic concentration of TIQ-A and PJ34, toxic concentration of Olaparib) and 10 μM (toxic concentration of all PARPi).", "Adult OPCs were treated with all 10 μM and 1 μM (both non-toxic concentration of all PARPi).", "Representative HCS images of CNPase/MBP-positive cells in the different treatments of both fetal and adult OPCs are presented in Fig. 4B; results of the quantitative HCS analysis in Fig. 4C (fetal) and Fig. 4D (adult).", "The number of cells included in this analysis ranged from 1199 to 7152/well.", "Three wells were included in each experiment.", "PARP inhibition impairs OPCs maturation in fetal, but not in adult, cultures.", "In cell preparations derived from fetal brain, TIQ-A, the less potent PARPi, does not affect OPC maturation, as indicated by the percentage of MBP-IR cells.", "On the contrary, PJ34 treatment, already at non-toxic concentrations (1 μM) resulted in a reduction of mature OPCs (P = 0.0013), as when used in a toxic dose (10 μM) (P < 0.0001).", "Olaparib treatment at both concentrations resulted in a strong reduction of the percentage of mature and myelinating OPCs (P < 0.0001).", "Notably, all PARPi had no effect on adult OPC differentiation (1 μM treatment, data not shown).", "Several in vivo and in vitro studies indicate that OPCs have substantially different properties according to their chronological age.", "For example, human fetal OPCs from different gestational stages exhibit differences in the myelination profile (Cui et al., 2012), such as human OPCs derived from fetal brain during the period of maximum oligoneogenesis or from adult subcortical white matter (Windrem et al., 2004).", "However, the mechanisms behind the different age-related OPC biological properties are not known.", "The aim of this study was to investigate if PARP is involved in determining the age-related OPCs properties.", "Thus, we compared OPCs derived from NSCs obtained from fetal and adult brains.", "This cell system was preferred to primary and purified OPCs to better mimic developmental biology of OPC, including lineage specification, proliferation/survival and differentiation.", "PARP is a family of enzymes comprising 17 homologues involved in multiple cell functions (Jubin et al., 2016a).", "Apart from the role in DNA repair, PARP-1 and 2 participate in cell homeostasis maintenance (Bai, 2015), intracellular transports (Abd Elmageed et al., 2012), cell cycle (Madison et al., 2011) inflammation and immunity (Bai and Virág, 2012) and gene expression regulation (Bock et al., 2015) through > 100 substrates (Hottiger, 2015).", "Moreover, PARPs are critically involved in inflammation and in the tissue damage caused by ischemia/reperfusion conditions (Li et al., 2015).", "We first showed that PARP mRNA expression and PARP activity are much higher in fetal- than in adult-derived OPCs.", "Due to the role of PARPs in DNA repair and apoptosis induction (Heeres and Hergenrother, 2007), the reduction in PARP mRNA expression level and activity observed in adult compared to fetal-derived OPC might reflect the age-related decrease of DNA repair capability (Bürkle et al., 2015).", "In fact, PARP activity also varies according to the age in different brain regions (Strosznajder et al., 2000), and PARylation is developmentally regulated (Jubin et al., 2016b).", "We then showed that PARP inhibition produces substantially different effects in OPCs derived from fetal and adult brain.", "In particular: (i) the culture treatment with PARP inhibitors is cytotoxic for OPCs derived from fetal, but not from adult, brain; (ii) PARP inhibition reduces cell number in proportion to the inhibitory potency of the compounds; (iii) the PARP inhibition effect in fetal OPCs is a slow process (iv) PARP inhibition impairs OPC maturation into myelinating OL in fetal, but not in adult OPCs, according to the inhibitory potency of the compounds.", "A primary role of PARP in the differentiation process of different cell types was recently recognized, possibly though chromatin plasticity and epigenetic regulation (Li et al., 2015).", "In embryonic stem cells, PARP interacts with the Wnt pathway, Sonic Hedgehog and Pax6 signalling (Hemberger et al., 2003; Yoo et al., 2011).", "PARP-1 has also a role in neuroectoderm differentiation (Yoo et al., 2011) and favours the transit of NSCs toward a glial fate (Plane et al., 2012).", "Here we confirmed and further extend this latter observation, showing that PARP inhibition reduced proliferation in fetal-derived neurospheres and oligospheres (see supplemental material), and reduces OPCs differentiation into mature OLs.", "Notably, key transcription factors involved in OPC maturation, i.e. retinoic acid receptors, thyroid hormone receptors and their hetero-dimerization, such as PDGF signalling, a critical pathway for OPC biology, are targets of PARP regulation (Pavri et al., 2005; Allen, 2008).", "Overall, these results suggest that a different PARP signalling in fetal and adult OPCs might be part in the biological properties of OPCs at different chronological ages.", "These results have also therapeutic implications.", "In fact, PARP inhibition has even been proposed as a pharmacological strategy in a number of acquired inflammation/demyelinating disorders in which OPCs play a key pathogenic role, occurring both in perinatal/neonatal (e.g. neonatal hypoxia/ischemia encephalopathy) and adult age (e.g. spinal cord injury and multiple sclerosis; Komjáti et al., 2005; Moroni, 2008; Cavone and Chiarugi, 2012).", "Contradictory results have been obtained in mice models of inflammatory/demyelinating diseases (Selvaraj et al., 2009; Veto et al., 2010; Casaccia, 2011; Kamboj et al., 2013).", "PARP-2 deletion in conventional transgenic mice results in a protection from experimental allergic encephalomyelitis (EAE), the most widely used animal model for multiple sclerosis (Kamboj et al., 2013).", "Conversely, knock-out of PARP-1 gene leads to an exacerbated EAE and an increase in the mortality rate (Selvaraj et al., 2009).", "Pharmacological PARP inhibition in EAE mice has a protective effect, preventing OL death and attenuating inflammation (Veto et al., 2010), although this effect is attributed to the reduction of CNS inflammation and immunomodulation (Scott et al., 2004).", "Our data, showing that PARP inhibition is cytotoxic in OPCs derived from the fetal brain, suggest that the OPCs chronological age should be taken into account in considering PARP inhibition as a neuroprotective strategy.", "In particular, PARP inhibition in ischemic damage should distinguish perinatal/neonatal from adult conditions, considering that the time-window for the treatment of neonatal hypoxia/ischemia encephalopathy is the key period for OPCs proliferation, maturation and developmental myelination." ]

[ "Oligodendrocyte precursor cell (OPC) were derived from fetal and adult neural stem cells.", "PARP activity is much higher in fetal than adult—derived OPC.", "PARP inhibition is toxic for fetal, but not adult OPC, also impairing OPC differentiation." ]

[ "AGRI", "ENVI" ]

[ "Ginseng", "Overbrowsing", "Panax quinquefolius", "Plant demography", "Refugium" ]

[ "1105", "2303", "2309" ]

[ "“Since then I have lived to see state after state extirpate its wolves.", "I have watched the face of many a newly wolfless mountain, and seen the south-facing slopes wrinkle with a maze of new deer trails.", "I have seen every edible bush and seedling browsed, first to anemic desuetude, and then to death.”", "–Aldo Leopold, from ‘Thinking Like a Mountain’, Sand County Almanac, 1949", "Since publication of Leopold's iconic Sand County Almanac, numerous studies have demonstrated the cascading effects of predator removal and predator re-introduction in a diverse array of biological communities (Pace et al., 1999).", "While many of the classic cases of trophic cascades were described in aquatic systems (Paine, 1966), profound impacts of top predator abundance have been demonstrated repeatedly in terrestrial communities as well (Schmitz et al., 2000; Terborgh et al., 2001; Rooney and Waller, 2003; Beschta and Ripple, 2009).", "In systems where herbivore abundance strongly affects vegetation, the loss of keystone predators can be particularly impactful (Côté et al., 2004).", "Overabundant herbivores can then shape the vegetation over time by profoundly altering recruitment patterns of overstory trees and reducing both abundance and diversity of the understory (Waller and Alverson, 1997; Russell et al., 2001; Côté et al., 2004; Habeck and Schultz, 2015).", "In the eastern deciduous forest of the U. S., two top predators have been functionally extinct for more than a century.", "Eastern cougars (Puma concolor) were officially declared extinct in 2011, but this reflected a condition that had existed for approximately 8 decades (U. S. Fish and Wildlife Service, 2011), and they were uncommon to rare for several decades prior to that.", "The other top predator in eastern forests, the gray wolf (Canis lupus), had a similar history of being functionally extinct in most of its former eastern range by 1900 (Carson et al., 2014).", "Hunting by humans also kept white-tailed deer populations (Odocoileus virgianus) low, along with their predators.", "Over the past several decades, management by state wildlife agencies on behalf of human hunters successfully resurrected large deer herds, ultimately resulting in densities that have far exceeded those found in pre-settlement forests in most regions (Waller and Alverson, 1997; Russell et al., 2001; Côté et al., 2004; Habeck and Schultz, 2015).", "The subsequent widespread overbrowsing of understory tree seedlings, shrubs, and herbaceous understory plants is well-documented (Rooney and Waller, 2003; Côté et al., 2004).", "Indeed, it has been argued that the absence of keystone predators along with mismanagement of their populations resulted in white-tailed deer being recognized as keystone species in its own right (Waller and Alverson, 1997) due to their broad-ranging impacts on the entire ecosystem.", "Frequently, ecologists have been concerned that common understory plant species may be gradually going extinct due to overbrowsing (Carson et al., 2014).", "Particular attention has been paid to browsing of seedlings and saplings of commercially valuable tree species that appear to be favored foods of deer (Côté et al., 2004; Bradshaw and Waller, 2016).", "However, since overstory trees persist for decades to centuries, future overstory species composition, not outright extinction, has been the primary immediate concern with trees.", "Somewhat less attention has been paid to effects of overbrowsing on forest understory herbaceous plants, probably because many have little direct economic value.", "In addition, due to the longevity of most understory herbs and the existence of perennating structures underground, the long-term effects of herbivory are difficult to observe over short time spans.", "Yet it would be valuable to identify populations in this stage of ‘anemic desuetude’ as a precursor to extinction in order to enable conservation action prior to critical endangerment.", "Among understory species that have been studied with respect to deer herbivory, Trillium, a showy and palatable understory wildflower species, has provided an excellent model species (Anderson, 1994; Augustine and Frelich, 1998; Rooney and Gross, 2003; Jenkins et al., 2007; Knight et al., 2009; Kalisz et al., 2014).", "Anderson (1994) showed that mean height of Trillium plants was a strong indicator of deer browse intensity.", "Beauvais et al. (2017) even showed that reduced plant sizes in deer-browsed sites were reflected in the record of herbarium specimens.", "Rooney and Gross (2003) demonstrated population declines of 3.5% per year, even with relatively low browse rates.", "Jenkins et al. (2007) demonstrated the effect of herbivory in truncating the age-structure of natural populations in Great Smokey Mountain National Park, TN, U.S.A. Using matrix models for 12 Pennsylvania populations, Knight et al. (2009) demonstrated that a browse rate of only 15% was sufficient to threaten Trillium's long-term persistence.", "Several approaches have been employed to evaluate deer browse effects, each with its own advantages and disadvantages.", "Some studies have compared dynamics of different populations that naturally experience contrasting browse rates (e.g., Knight et al., 2009); this has the advantage of examining realistic rates in the current environment, but may not include populations at ‘natural’ pre-settlement rates, or browse rates that would be ‘desirable’ from a conservation standpoint.", "In addition, the reasons for the differences in browse rates (e.g., proximity to edge habitat) may be correlated with other factors (e.g., light) that also influence plant population dynamics.", "Others have modeled deer browse effects by removing or including browsed plants from the data set in the calculation of vital rates (e.g., Rooney and Gross, 2003; McGraw and Furedi, 2005); this allows for easy manipulation of browse rates and allows a nice dissection of affected model parameters, though it assumes browse effects on an individual are confined to a particular year.", "Others have taken an experimental approach, fencing areas to remove deer and observing the response over time (e.g., Augustine and Frelich, 1998; Heckel et al., 2010; Kalisz et al., 2014; Sabo et al., 2017; Wilbur et al., 2017).", "Exclusion experiments permit a rigorous, spatially controlled test of browse effects and result in an entire community response; therefore they are well-suited to examining rates of recovery following release from high browsing rates.", "However, unless such experiments are very long-term, allowing re-colonization by a full complement of understory plants, this approach primarily captures the initial recovery period, rather than a continuous condition of low browse rates.", "Finally, a few studies have used naturally-occurring refugia within populations exposed to browsing (Rooney, 1997; Carson et al., 2005); if the refugia have been in existence for a long time, then plant demography in the refugium presumably reflects performance, including the whole-community effects such as increased competition, that may counter some positive effects of no browsing.", "However, in extreme refugia, browse rates may be zero, which could be unrealistically low relative to a desirable, or generally achievable, rate.", "In long-term demographic studies of the widespread medicinal plant, American ginseng, early work focused on human harvest, but deer browsing occurs at much higher rates than harvest (Furedi, 2004; McGraw and Furedi, 2005).", "Unlike Trillium, ginseng is not a ‘preferred’ food plant for deer, an idea supported by detailed analyses of interactions between deer and plants observed with wildlife cameras (Hruska et al., 2014), and the fact that deer will often only partially browse the leaves on a given plant that is within easy reach.", "However, deer will consume the aboveground stalk, leaves, flowers and fruits occasionally, especially as other understory plants become scarce.", "Though browsing rates varied among populations and years, most populations censused did experience significant loss of reproductive adult plants by the end of each growing season (Furedi, 2004).", "These losses catalyzed reduced population growth rates both through lost reproduction and reduced plant size (Furedi, 2004; Farrington et al., 2008).", "Using the data removal approach described above, McGraw and Furedi (2005) showed that virtually all ginseng populations have low population viability at current rates of deer browse, but would be viable with significant reductions in browse.", "Experimental studies confirmed that in addition to consuming leaf material, deer were ginseng seed predators, and not dispersers (Furedi and McGraw, 2004).", "Defoliation, especially early in the season, was shown to decrease plant size and reproductive output in ginseng (Furedi, 2004, Farrington et al., 2008).", "A decrease in stature of plants in herbarium specimens was also shown over the past two centuries, consistent with hypotheses about effects of both human harvest and deer browse (McGraw, 2001).", "Virtually all ginseng populations studied have experienced significant browse; therefore it is not known what characteristics a ginseng population would have in a forest with a rich, dense understory that has not been strongly impacted by deer.", "However, in one population we censused for 20 seasons, we were fortunate to discover a subset of plants growing on top of an isolated, flat-topped, 2.5–4 m high ‘boulder’ that has not experienced deer browsing in its history.", "This ‘control’ group allowed us to examine effects of chronic overbrowsing in order to characterize the nature of ‘anemic desuetude’ in the rest of the population in a demographic sense.", "Therefore, in this study, we (1) examined growth, survival, and reproduction in the two groups of plants, (2) projected relative population growth rates, (3) performed a life table response analysis, dissecting the cause of differential population growth rates, and (4) tested whether size structure differences on and off the rock could yield a static signature of browse intensity across many populations.", "Based on prior studies of browse effects, we expected that the browse-exposed population off the perched rock would experience reduced performance in all three measures, relative to the on rock (protected) subgroup, and that this would in turn reduce population growth rate in equal measure.", "We further hypothesized that demographically Aldo Leopold's ‘anemic desuetude’ would be evident in population-level performance over time, and this would be in turn manifested at a given point in time by large differences in the size structures resulting from those demographic contrasts.", "We expected that the life table response analysis would show deer effects on population growth by mechanisms related to both growth and reproduction.", "Coopers Rock State Forest is a 5158 ha forest in northern West Virginia, U. S. A.", "The primary feature of the forest is the 400 m deep canyon cut by the Cheat River.", "The upper margins of the canyon and other stream-dissected areas of the forest are rimmed by weather-resistant Pottsville sandstone.", "As streams or rivers cut away less-resistant layers beneath, large blocks of Pottsville sandstone break away to form intact blocks of rock isolated by large cracks that eventually erode to isolate the forest community on top of them.", "Such blocks are found wherever this erosion pattern exposes the edge of the resistant sandstones, and they range in size from a few square meters to >1000 m2 and 1–40 m high.", "On one such sandstone block (ca. 12 m × 26 m), the continuous 2.5–4 m high vertical wall on all sides was sufficient to prevent white-tailed deer from browsing the vegetation, resulting in sharply contrasting forest floor vegetation (Fig. 1).", "Except near the rock edges, soil depth was similar to the surrounding off-rock areas, and supported tree growth.", "While the overstory was not different from the surrounding vegetation, the herbaceous vegetative cover was continuous on the rock, and the understory flora was far taller and more diverse than the surrounding off-rock community.", "Vegetative cover in the off-rock community varied between 0 and ∼10%.", "During our early surveys of Population 27 in the off-rock surroundings, we discovered three clusters of ginseng plants on top of the rock.", "They were formally censused (procedure described below) along with the surrounding population since 1998.", "Beginning in 1998, two formal censuses were performed annually through summer, 2017.", "Since ginseng is harvested, plants were marked cryptically with subterranean aluminum nails engraved with unique identifying numbers.", "In spring (between May 25 and June 15) each year, all marked plants were visited and scored for presence, number of leaves, height of stalk, length of longest leaflet on each leaf, width of longest leaflet on each leaf, reproductive status (forming buds or not), as well as evidence of harvest, browse, insect damage and fungal disease.", "In late summer (July 25 – August 15), plants were revisited, berries and seeds were counted, and damage status was re-assessed.", "Leaf area for each plant was estimated by multiple regression using maximum leaflet lengths and widths, then summing across all leaves on the plant (Souther and McGraw, 2011a).", "Two independent estimates of annual deer browsing rates were made.", "First, monitoring every 3 wk by Furedi (2004) showed that vegetative stalks persisted for 3–4 weeks after browsing.", "Therefore, in the two censuses occurring in all other years, we estimated that we effectively sampled browsing for 6 weeks of the ca. 15 wk growing season.", "Hence, the number of observed browsed stalks was multiplied by 2.5 as one estimate of browse rate.", "This first estimate may have underestimated browse rates because some browsed stalks may have been missed in each census (they are harder to visually detect than plants with leaves).", "A second estimate of browse rate was done by adding the total number of ‘missing’ plants in the population that were known to be alive because they emerged in a later year.", "This rate probably overestimated browse because it assumed that missing plants were entirely due to deer, however other factors could have caused them to be missing in any given year (e.g., rodent, rabbit, ground hog browsing), though these other causes were likely to be infrequent.", "Both measures were used to estimate an average browse rate for ginseng in the focus population, but also to provide a comparison with 30 populations censused in the same way across 7 states (Indiana, Kentucky, Maryland, New York, Pennsylvania, Virginia, and West Virginia; McGraw et al., 2017).", "All of these populations were censused annually from 2004 to 2016.", "To estimate growth rate, we used a non-destructive approach by examining the relative growth rate of leaf area (RGR-LA) for any plant that persisted for at least 5 years in the population (McGraw and Garbutt, 1990).", "The slope of ln (leaf area) vs. year was used as the estimate of RGR-LA.", "RGR-LA for plants on and off the rock was compared with a t-test.", "Survival was assessed annually for all plants on and off the rock.", "Since survival is known to be size-dependent and to vary among years, both leaf area and year were included in the logistic model, as well as location on or off the rock with ‘survived/died’ as the dependent variable.", "Total reproductive output via seeds was broken into two components; (a) produced seeds or did not produce seeds, and (b) for seed-producing plants, the number of seeds produced.", "The former was scored at the fall census based upon the presence of forming berries and was a nominal dependent variable.", "The latter was scored by counting bulges in each forming berry and summing for each plant.", "Berries contain 1, 2, and infrequently, 3 seeds so accurate counts were readily obtained.", "Natural log of seed number was analyzed with a general linear model having plant size and year as independent variables, along with location on or off the rock.", "All one-leaf plants were excluded from both of these analyses as ginseng is not able to produce seeds at that life history stage.", "The census interval was from spring census (t) to the following spring census (t+1).", "Since new seedlings germinated in May and were counted at the spring census, this number accounted for any seedling losses prior to the census.", "Deaths were counted as plants that were alive at census t, but were missing at the second census and were not seen for at least two growing seasons later.", "Because occasional early browsing or other damage to the meristem may prevent a plant from being observed aboveground at the spring census in a given year, we waited two growing seasons to pronounce the individual as ‘dead’.", "Hence the observed population change concluded in 2015 (using the 2016 and 2017 censuses to confirm death).", "In the course of censusing, we added new (previously undiscovered, non-seedling) plants to the census as they were found.", "These new plants were not used in calculating net population change until the following year.", "The relative changes on and off the rock were illustrated by starting with a theoretical cohort of 100 in both locations, and multiplying by the observed Nt+1/Nt at each location for every year between 2005 and 2015.", "We chose to use the traditional discrete-class matrix structure (Caswell, 2001) rather than an integral projection model for this analysis because unlike some plants that have more continuous size variation, ginseng does exhibit discrete ‘behaviors’ in the early life history stages (seeds, seedling 1-leaf, and juvenile 2-leaf).", "In addition, sample sizes were limited in the adult classes, in part due to effects of herbivory (Furedi, 2004).", "The 1-leaf plants, distinctive because none produced flowers or berries, were split into new seedlings and >1 y old seedlings.", "New seedlings had lower survival and growth than older 1-leaf plants as the former are in the early phases of establishing a tap root, and are more vulnerable to mid-season drought and other stresses.", "Juvenile plants having two leaves are distinct from 1-leaf plants because most of them do produce flowers, and therefore can act as males in the population.", "However, production of the large seeds and fleshy fruit is rare to infrequent in this intermediate stage.", "The juvenile 2-leaf plants were split into equal size small (<50 cm2 leaf area) and large (>50 cm2) classes.", "Adults (3-leaf and 4-leaf plants) were partitioned into three size classes based on log-linear divisions based on leaf area (small adults, <100 cm2; medium adults, 100 cm2 < leaf area<250 cm2; large adults, >250 cm2); this partitioning accounts for the significantly greater seed production in larger adults than in smaller adults.", "Using leaf area to distinguish classes of 2-leaf and larger plants allowed for growth, stasis, or shrinkage between years; the latter was particularly important for the resulting model in determining accurate population growth rates and explaining population growth rate differences (Salguero-Gomez and Casper, 2010).", "Due to innate dormancy that is released only after two winters, all individuals pass through a seed stage in the soil.", "Although ginseng seeds have been shown to persist in the soil at some sites for up to 4 years, in Population 27, two sequential on-site seed cage studies showed persistence for only 2 years at this site.", "Therefore two seed stage classes were included in the matrix model; 9 month old and 21 month old seeds (age when censused in late spring).", "The seed cage study allowed us to calculate initial 9 month survival, survival within the seed bank from 9 to 21 months, and germination from the 9 month old and 21 month old seed pools.", "Size-specific fertilities (mean number of 9 month old seeds per adult of each size class the previous year) were determined as the product of seed number, 9 month survival observed in the seed cage study and a loss rate specific to on rock vs. off rock environments.", "This loss rate was included because seed cages protected dispersed seeds to an unknown degree.", "To calculate the loss rate we determined the ratio of observed new seedlings to the expected new seedling number based upon seed production and 9 month survival.", "The transition probability from 9 to 21 month old seeds was determined directly as the mean of the two seed cage studies (Souther and McGraw, 2011b).", "Germination rates (transition from seed to 1-leaf new seedlings) were also determined from the seed cage study.", "The results of the age-, stage- and size-based class partitioning of the life history was a 9 × 9 transition probability matrix model.", "Transition matrices were determined for each pair of years from 2005 to 2014 (ten total matrices) for the off rock subpopulation.", "The sample size ranged from 355 to 428, resulting in a well-parameterized model.", "In years prior to 2005, a small amount of harvest occurred and therefore in order to focus on deer browse effects in isolation, we did not include those years in this study.", "Transition matrices from 2015 onward could not be estimated because of the unknown mortality status of missing plants.", "The deer-isolated ‘on rock’ subpopulation numbered between 7 and 30 plants in the 20 census years.", "This number of observations was insufficient to construct a separate population projection matrix for each year.", "To construct a matrix for comparison to the off rock subpopulation, we pooled the transition observations across pairs of years to construct a single matrix.", "While the observations were therefore not entirely independent as some individuals were repeatedly sampled, these observations were made across ten widely varying growing seasons and provided a good composite measure of demographic response to the on rock environment.", "To examine how a static population measure could indicate a state of long-term overbrowsing, we examined the stable size distribution differences between the on rock composite matrix and off rock mean matrix of Population 27.", "Next, in order to test the fidelity of our proposed indicators beyond Population 27, we examined the association between several possible size structure indicators (proportion of 1-leaf seedlings, proportion of 2-leaf juveniles, proportion of adults, and ratio of non-juveniles to juveniles) and our two browse estimates in 30 natural populations over a wide area by correlation analysis.", "All asymptotic population statistics were determined using MATLAB (v. R2015b, The Mathworks, Inc.).", "The overall browse rate for Population 27 (the focus population of this study) was slightly above the 30-population median by either measure; ranking 12th (out of 30) by one measure and 14th (out of 30) by the other (Fig. 2).", "Population 27 is therefore near the middle of the set of natural populations we studied across seven eastern U.S. states.", "The focus population's annual browse rate estimate was 20–25% by the two measures used in this study.", "No plants on the rock were browsed in any of the 20 census years (1998–2017).", "Mean relative growth rate of plants that persisted at least 5 years on the rock was higher than the same measure for the surrounding population (Fig. 3A).", "Plants on the rock had an RGR significantly greater than 0 (one-sample t-test, t = 4.1514, p = 0.0013), indicating an increase in mean plant leaf area.", "Indeed, after a decade, mean leaf area of plants on the rock nearly tripled.", "However, mean RGR-LA for plants in the browse-exposed population was negative, showing a declining leaf area (one sample t-test; t = −1.6749, p = 0.0473).", "This corresponded to a 10% decline in mean leaf area over a decade in the browse-exposed portion of the population.", "Survival of individual plants to the following year was size-dependent, as expected (Leaf Area Effect, Likelihood Ratio Chi-square = 94.5375, p < 0.0001).", "There was no statistical support for a survival difference between locations (Location Effect L-R Chi-square = 1.2868, p = 0.2566).", "However, the effect of size on survival depended on location (Location x Leaf Area Effect, L-R Chi-square = 4.3360, p = 0.0373).", "Inspection of the logistic regressions of survival on size at the two locations showed that survival was lower at small sizes on the rock, but this pattern was reversed above a size threshold of ca. 37 cm2 (Fig. 3B).", "No evidence was found to support a main effect of location on components of reproduction (on vs. off the rock; p > 0.10).", "The chance that a plant would produce seeds increased only as a function of size (L-R Chi-square = 180.5527, p < 0.0001).", "In addition, the effect of size on whether a plant was reproductive did not depend on the location (p > 0.10).", "With separate logistic regressions, on rock and off rock plants showed similar patterns of sharply increasing reproductive probabilities with plant size (Fig. 3C).", "For plants that successfully produced berries, mean number of seeds was a function only of plant leaf area (FLeaf area = 84.8808, p < 0.0001) and not location (FLocation = 0.0168, p = 0.8970), but there was a trend suggesting a dependency of the size effect on location (FLeaf Area x Location = 3.3220, p = 0.0688).", "Predicted seed numbers tended to be greater for small reproductive plants on the rock than for those off the rock, but this pattern was reversed for large plants (Fig. 3D).", "The bulk of the population (91% as of 2017) was located off the rock, and this part of the population declined steadily in numbers from 2005 to 2015 at a rate equivalent to 4.5%/y (Fig. 4).", "By contrast, the small subpopulation on the rock grew haltingly with episodic recruitment, with a net increase of 50% after one decade.", "This continued for the following two summers, by which time the number of plants had nearly tripled in number due to a second large pulse of new seedlings (data not shown).", "Based on the mean population projection matrix for the off rock subpopulation, that group of plants was predicted to shrink in numbers at a rate of 4.51% per year when at the stable stage distribution (Fig. 5A).", "This was almost precisely the same as the observed annual rate of decline from 2005 to 2015.", "Meanwhile, the on rock subpopulation was predicted to increase at a rate of 3.73% per year (Fig. 5A).", "This rate would translate to a 44% rate of increase over a decade, again not very different from the observed rate from 2005 to 2015, though clearly the on rock plants were not in a stable stage distribution.", "Remarkably, the LTRE clearly showed that all six of the top positive contributors to the difference in λ between on rock and off rock subpopulations were due to contrasts in matrix parameters describing growth to larger classes (Fig. 5B).", "Growth into the largest and second largest adult classes were most important, followed by growth into the small adult class.", "Size-specific fertility parameter differences on and off the rock were not important contributors to Δλ, all having absolute values < 0.002 (data not shown).", "The stable stage distribution of the composite matrix for the on rock subpopulation and the mean matrix for the off rock subpopulations in Population 27 showed distinct differences in almost all stages (Fig. 6).", "The on rock subpopulation had more seeds in the soil, more new seedlings and more medium and large adults, as a proportion of the total in the stable stage distribution, while the off the rock subpopulation was enhanced in the older seedling and juvenile categories.", "By placing Population 27 in the broader context of 30 natural populations, we were able to examine which of the size structure indices showed a correlation to the browse indices.", "Indeed, almost all of the size structure indices showed some correlation to browse.", "For example, the larger the number of browsed stems observed with eaten stalks (browse estimate 1), the fewer 1-leaf plants were found in the population (r = −0.6222,p = 0.0002).", "The strongest association was the positive correlation shown between the second browse estimate and the proportion of the population in the 2-leaf plant classes (Fig. 7).", "Across the 30 populations, the proportion of juveniles ranged widely, from 17 to 58% of the whole population.", "At the upper end, these proportions corresponded with browse estimates of more than 40%.", "Compared with the other 29 populations, Population 27 was near the middle of the scatterplot (Fig. 7), again suggesting it was not atypical.", "Interpreting individual- and population-level contrasts between on rock and off rock subpopulations as a browse effect makes the assumption that absence or presence of deer was the only difference between the two environments.", "Sensu stricto, this is clearly not the case.", "One obvious difference is soil depth on the rock, which could in turn affect water and nutrient availability.", "In August 2017, we measured soil depth in the vicinity of ginseng plants on the rock and found an O horizon varying between 5 and 35 cm deep, with almost no other soil horizons above the perched rock surface.", "From prior experience digging ginseng roots, we find most rooting does occur within this depth range, however fine roots accessing deeper water supplies are found in larger plants at sites with deeper soils.", "The prediction of greater drought stress on the rock was reinforced by notations on our annual August census sheets of wilting or early senescence in 5 of 20 census years.", "Relatively undeveloped soil would likely reduce ginseng growth on the rock relative to an unbrowsed condition off the rock, thus underestimating the negative ‘effect of browse’ relative to what we observed; our ‘browse effect’ interpretation is likely conservative.", "Another abiotic contrast of the on rock and off rock microsites could be overstory canopy coverage.", "In other work, ginseng responded positively to smaller canopy openings (Wagner and McGraw, 2013; Chandler and McGraw, 2015, 2017).", "However, the rock surface was small, and large trees adjacent to it were overhanging the rock subpopulation.", "In addition, multiple trees up to 15 cm in diameter were growing on the rock surface itself, such that the tree canopy difference was minimal.", "Intense shading from herbaceous competitors, likely an indirect deer browse effect, would have more than compensated for any reduction in tree canopy experienced by ginseng plants on the rock (see Fig. 1), again making the abiotic environment more favorable for the off rock subpopulation with respect to light.", "We therefore conclude that browse difference between on rock and off rock subpopulations would have been even greater if the lower quality microenvironment on the rock had not tempered the contrast.", "Comisky et al. (2005) demonstrated that low rocks in the Alleghany National Forest that were exposed to browse closely resembled the off rock vegetation, while high browse-protected rocks acted as refugia, with higher species diversity and much higher reproductive output from herbaceous plants found there.", "This affirms our interpretation that the overwhelming observed difference between the high rock and the surrounding vegetation was due to deer browse.", "Over 30 wide-ranging populations, two browse estimates revealed a wide range of browse rates (1.5%–67% for one measure; 12%–44% for the other) for ginseng populations without obvious deer refugia (McGraw et al., 2017).", "No precise measure is available because populations would have to be visited at least 6 times during the season to assess actual browse rates and such a high human visitation rate could itself alter browse probability.", "Therefore, some uncertainty in natural browse rates is inevitable.", "The two estimates were similar, and near the median, for Population 27 (20–25% each season); we conclude that this population is representative of deer impacts in the middle range of those experienced by natural populations.", "The presence of a ‘control’ group of plants in unbrowsed vegetation atop a rock therefore presented a unique opportunity to examine ‘average’ effects of browsing on this species.", "There was only one such ‘control’ group within one of the 30 populations, however the fact that it was typical of other populations with respect to deer browse suggests that our findings are more broadly relevant.", "Contradicting our original hypothesis, browse effects on survival, growth, and reproductive were not spread evenly across size-dependent measures on individual plants.", "Instead, the primary effect of exposure to browse was to reduce the size-dependent growth rate (RGR-LA) of individuals in the browse-exposed region of the population to a mean that was negative; plants off the rock were actually shrinking in mean leaf area.", "This pattern of shrinkage following browse has been observed for other understory species, such as Trillium (Knight et al., 2009).", "We interpret this slow decline in mean size of plants as a primary signal of Aldo Leopold's ‘anemic desuetude’ (Leopold, 1949) at the plant level for this forest floor herb.", "Because smaller plant size results in higher mortality and lower reproductive output, browse has consequences for these components of plant performance as well at the population level, but there were only subtle differences between off rock and on rock plants in terms of their size-dependent survival and reproduction.", "Physiologically, the effect of browsing on growth is explained by the fact that it curtails energy storage in the tap root for re-growth the following growing season.", "Ginseng, like most understory perennials, exhibits deterministic growth within a growing season, and the top does not re-grow once browsed.", "Therefore, a shortened growing season effectively reduces energy storage in the form of non-structural carbohydrates in the root.", "Smaller ‘adult’ plant sizes have been identified in other deer-browsed understory species as well, including reduced height and leaf area in Trillium (Anderson, 1994, Beauvais et al., 2017), and reduced leaf size in Maianthemum (Rooney, 1997).", "Off the rock, deer may also have had nonconsumptive, indirect effects as well.", "In Arisaema triphyllum, for example, Heckel et al. (2010) found that deer activity increases soil compaction and decreases leaf litter depth, contributing to declines in A. triphyllum size and seed rain, and resulting in shifts toward male-dominated populations, even though this species was rarely consumed by deer.", "Sabo et al. (2017) further suggested that the direct effect of deer browse were compounded by deer-mediated environmental alterations, including soil compaction.", "The contrasting performance of individual plants was reflected in demographic projections that forecasted long-term increases in the rock subpopulation, and by contrast, declines in the off rock subpopulation.", "Indeed, although the browse-protected subpopulation showed episodic recruitment and stochastic fluctuations typical of low N populations, the net change over a decade nevertheless closely reflected the long-term positive trajectory predicted by the composite projection matrix model for those plants.", "The decline seen off the rock, based on larger numbers, was steadier over time, and again reflected the projections closely.", "The modeling projections assumed non-connectivity between on-rock and off-rock subpopulations, which strictly speaking is not the case.", "However, the model projections closely mirrored observed changes, so if, for example, seed production from the boulder subpopulation was altering population change off the rock, its effect was undetectable.", "The LTRE showed that greater rates of growth to larger size classes (reflecting higher RGR) was the primary reason for higher growth rate in the browse-protected group of plants on the rock within Population 27; reinforcing the primacy of growth effects at the population level.", "The contrasting demographic parameters resulted in altered stable stage distributions, which, in turn, reflected the state of ‘anemic desuetude’ in the population.", "The high proportion of ‘juvenile’ 2-leaf plants in ginseng may be the best indicator that deer have been chronically overbrowsing a population.", "By contrast, a large proportion of new seedlings (reflecting a larger seed pool) and a large proportion of large fecund adults is likely an indicator that a population is not being overbrowsed.", "A juvenile-heavy stage-distribution was also found to be a consequence of harvest by humans (Mooney and McGraw, 2009).", "However, when humans harvest plants, unlike deer, the roots are destroyed – the skewed structure in that case is a consequence of removing larger individuals from the population, not due to stunting.", "This suggests a way to distinguish anemic desuetude produced by deer and the skewed distribution produced by human harvesters: In the case of deer, a large proportion of 2-leaf ‘juvenile’ plants are likely to be old ‘stunted’ individuals, while in human harvested populations, juveniles will largely be young, growing, and in the process of transitioning from seedling to adult.", "In ginseng, ages can be determined by counting annual bud scars on the rhizome (Lewis and Zenger, 1982).", "Indeed, in the complete published data set for 30 populations of ginseng (McGraw et al., 2017), although only a small proportion of older plants were aged using the bud scar approach, 36% of the observations of plants more than 30 years old were 2-leaf ‘juvenile’ plants, and one of these was more than 50 years old.", "This pattern is not readily explained by human harvest effects but is consistent with deer browse effects.", "Refugia such as large rock or boulder tops that are out of reach of deer could be important sources of recolonization of surrounding communities if browse rates were reduced through improved habitat management in the future (Carson et al., 2005).", "Within Population 27, the single rock top subpopulation of ginseng has become more significant over the 20 year census period.", "At the beginning of our censusing efforts (1998), the boulder top subpopulation comprised 3% of the plants and 2% of the seeds produced in the larger population.", "By 2017, the boulder subpopulation accounted for 9% of the plants and 37% of the seeds produced by the overall population.", "Given the subpopulation trajectories we showed, this trend is likely to continue.", "Indeed, certain other rock top species we noted (e.g., Sanguinaria canadensis, Asarum canadense, Actaea racemosa, Urtica dioica, Polygonatum odoratum and Thalyctrum sp.) were rare or absent altogether in the off rock community, suggesting that more palatable species were farther along on this trajectory.", "Ultimately, of course, density-dependence within ginseng will likely limit the boulder top subpopulation.", "Assuming no density-dependence to this point, backward projection suggests this group of plants originated ca. 9 decades ago.", "In practical terms, most forest communities are unlikely to contain many rock refugia to act as biodiversity preservation hotspots.", "Certain other microsites (e.g., slash left by logging operations or very steep slopes; Grisez, 1960, Rooney, 1997) may be somewhat protected from overbrowsing by deer, which could provide partial refugia.", "Land managers could also create refugia by fencing areas and allowing them to recover, however this strategy requires significant initial investment and maintenance to be effective in the long term.", "Moreover, recovery could be quite slow due to the ‘ghost of herbivory past’ (Carson et al., 2005); a general problem with the exclusion approach to conservation.", "The obvious more permanent remedy is to manage deer populations with the health of the ecosystem and biodiversity preservation as the primary goal (deCalesta and Stout, 1997; Rooney, 2001; Côté et al., 2004; Latham et al., 2005).", "When human hunting is inadequate for achieving this goal, reintroduction of top predators should be seriously considered (McShea, 2012).", "The success of such reintroduction efforts in certain regions of the world provides examples that could readily be followed, even in areas close to human-dominated habitats (Creel et al., 2005; Beschta and Ripple 2009, 2010).", "Recovery of vegetation from overbrowsing would likely be fastest for species such as ginseng that are secondary food sources for deer and therefore have persisted through decades of overbrowsing, albeit in a state of ‘anemic desuetude’.", "Recovery will also be more rapid for communities that do have natural refugia as a source of recolonization.", "Beyond their immediate importance for plant conservation, refugia from overbrowsing may be important for whole-community preservation.", "For example, pollinator guilds associated with rich understory vegetation (Motten, 1986) could be preserved within refugia.", "Ginseng seeds represent a food source for thrushes and other birds (Elza et al., 2016).", "Indeed, the origin of the on rock subpopulation was very likely seed dispersal by wood thrushes as they have been observed annually at that site.", "The degree to which isolated refugia can have cascading conservation effects has not been thoroughly investigated.", "As overbrowsing by deer remains unaddressed in much of the range of white-tailed deer in the eastern U. S., the role of refugia in preservation of biodiversity at all levels will likely continue to increase.", "The funding source had no role in study design, nor in collection, analysis and interpretation of data, nor in writing of this report or the decision to submit for publication." ]

[]

[ "BUSI", "DECI", "MATH" ]

[ "Currencies", "Investment strategy", "Optimization algorithms", "Profitable portfolios" ]

[ "1408", "1803", "2606", "2613" ]

["The ultimate objective of any investor, trader or manager is to speculate, to generate profits in (...TRUNCATED)

["Development of a new trading tool: the Modified Renko Bar (MRB).","We prove that the application o(...TRUNCATED)

[ "ENER" ]

["Case study","Electricity balancing","Forecast error time series","Market analysis","Variable renew(...TRUNCATED)

[ "2101" ]

["The increasing share of renewable electricity (RES-E) deployment required to reach the sustainabil(...TRUNCATED)

["Development of amount and composition of electricity imbalances by 2030.","Assessment of the futur(...TRUNCATED)

[ "BIOC", "CHEM" ]

["Cellular bioenergetics","Diabetes","Mesangial cells","Mitochondrial dysfunction","Renal cells","Tu(...TRUNCATED)

[ "1308", "1605" ]

["Diabetic nephropathy (DN) is a kidney disease which affects approximately one-third of patients wi(...TRUNCATED)

["The kidney as an organ has high bioenergetic needs.","Cultured renal mesangial and tubular cells h(...TRUNCATED)

[ "COMP" ]

["Bio-economic model","Fisheries management","Fleet dynamics","Impact assessment","Management strate(...TRUNCATED)

[ "1706", "1712" ]

["It describes fleet’s short term dynamics or tactical behaviour.","Each season it models how much(...TRUNCATED)

[]